ID: 922340009

View in Genome Browser
Species Human (GRCh38)
Location 1:224647661-224647683
Sequence CTCTGTCCTCTCTAGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 192}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922340009_922340015 -5 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340015 1:224647679-224647701 CAGAGGCTGGGACAGAGCCAAGG 0: 1
1: 0
2: 17
3: 219
4: 1109
922340009_922340023 19 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340023 1:224647703-224647725 TGTGTGGCTGGGTGGCACAGGGG 0: 1
1: 2
2: 1
3: 28
4: 450
922340009_922340019 11 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340019 1:224647695-224647717 GCCAAGGATGTGTGGCTGGGTGG 0: 1
1: 0
2: 2
3: 49
4: 332
922340009_922340016 3 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340016 1:224647687-224647709 GGGACAGAGCCAAGGATGTGTGG 0: 1
1: 0
2: 2
3: 32
4: 379
922340009_922340018 8 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340018 1:224647692-224647714 AGAGCCAAGGATGTGTGGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 240
922340009_922340017 7 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340017 1:224647691-224647713 CAGAGCCAAGGATGTGTGGCTGG 0: 1
1: 0
2: 4
3: 13
4: 315
922340009_922340021 17 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340021 1:224647701-224647723 GATGTGTGGCTGGGTGGCACAGG 0: 1
1: 0
2: 0
3: 23
4: 300
922340009_922340025 29 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340025 1:224647713-224647735 GGTGGCACAGGGGGAAGAGAAGG 0: 1
1: 0
2: 6
3: 115
4: 985
922340009_922340022 18 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340022 1:224647702-224647724 ATGTGTGGCTGGGTGGCACAGGG 0: 1
1: 0
2: 2
3: 25
4: 320
922340009_922340024 20 Left 922340009 1:224647661-224647683 CCCCACTTCTAGAGAGGACAGAG 0: 1
1: 1
2: 0
3: 16
4: 192
Right 922340024 1:224647704-224647726 GTGTGGCTGGGTGGCACAGGGGG 0: 1
1: 0
2: 3
3: 34
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922340009 Original CRISPR CTCTGTCCTCTCTAGAAGTG GGG (reversed) Intronic
900386158 1:2412055-2412077 CTCTGTCCCCTCCAGGTGTGAGG - Intronic
901581756 1:10250265-10250287 CTGTGTCGTCTCTAAAATTGAGG - Intronic
902794437 1:18791911-18791933 CTCTTTCCTCTTTAGACGTGGGG - Intergenic
905233320 1:36529193-36529215 CTCTGTCCTCTGAGGAAGGGGGG + Intergenic
907241353 1:53082976-53082998 CACAGGCCTGTCTAGAAGTGGGG + Intronic
907533835 1:55129245-55129267 CTCTTTCCCCTCTGGTAGTGGGG - Intronic
907719016 1:56954168-56954190 CTCTGTCCTCGCTAGAGGACAGG + Intronic
908703791 1:66929750-66929772 CTCTGACCTCTCTAGAGATTTGG + Intronic
909238358 1:73180994-73181016 CTCAGTCCTCTCCAGAATTTGGG - Intergenic
910836043 1:91511794-91511816 CTCTTTCCTTTCAAGAAGTACGG + Exonic
911323259 1:96440060-96440082 CTCTCTCCTCCCTAGGAATGGGG + Intergenic
912816582 1:112833579-112833601 TTCTCTCCTATCCAGAAGTGAGG + Intergenic
914432083 1:147627987-147628009 CTCTTTCCTCTCCTGAAGTTTGG + Intergenic
914826838 1:151143180-151143202 CACTGTCCTTTCTAGAGTTGAGG + Intronic
915815473 1:158961449-158961471 CTCTCTTCTCTCTACAAGAGTGG - Intronic
915962010 1:160274856-160274878 CTCTGTCCTCCCTAGAGGTTTGG - Intergenic
919644913 1:200086015-200086037 CTCTGTCCATTCTAGAATAGAGG + Intronic
920161733 1:204003782-204003804 CTCTGCCCTCCCTTGATGTGGGG - Intergenic
920415007 1:205793290-205793312 TGCTGTCCTCTCTAGATCTGTGG - Intronic
921047855 1:211490258-211490280 CTCAGTTCTCACTAGAGGTGAGG - Intronic
921124982 1:212169546-212169568 CTCAGTCCACACTTGAAGTGTGG + Intergenic
922340009 1:224647661-224647683 CTCTGTCCTCTCTAGAAGTGGGG - Intronic
922634761 1:227156850-227156872 CTCTATCCTCTCTGGAATGGTGG + Intronic
924022000 1:239793421-239793443 CTCACTCTTTTCTAGAAGTGTGG - Intronic
924796946 1:247299627-247299649 ATCTGTCCTGTCTAGGAATGTGG - Exonic
1063030996 10:2234030-2234052 CACTGTCTACTCTTGAAGTGGGG - Intergenic
1073904320 10:108259949-108259971 CTCTGTCCTTTTTAAAAGTTTGG + Intergenic
1076589733 10:131574789-131574811 CCCTGTCCACTCCAGAAGTGAGG - Intergenic
1078848047 11:15139543-15139565 CGCTGTCCTCACCAGAAGAGAGG + Intronic
1080063385 11:27981347-27981369 CTTAATCCTCTCTAGGAGTGAGG - Intergenic
1083075457 11:60032532-60032554 CTCTTTCCCCTCTAGAAATGGGG + Intergenic
1085381851 11:76127100-76127122 CTCTGTCTTCTCTACTAGAGTGG + Intronic
1088109372 11:106244902-106244924 CTCTCTCCTCCCCAAAAGTGAGG + Intergenic
1088849225 11:113691256-113691278 CACTGTCCTCATTAGAAGTTGGG - Intronic
1091775689 12:3183293-3183315 ATCTGTCCCCTCTCAAAGTGGGG + Intronic
1092124745 12:6067072-6067094 CGCTGCCCCCTCTAGAAGAGCGG + Intronic
1092475366 12:8814343-8814365 CTCTGGCCTCCCTTGCAGTGAGG + Intergenic
1094396220 12:30008731-30008753 TACTGTCCTCTCTAGAAGAGGGG + Intergenic
1095903945 12:47357994-47358016 CCCAGTCCTCTTCAGAAGTGTGG - Intergenic
1098378099 12:69838750-69838772 CTCTGGCCTTTCTGGAAGTCTGG - Intronic
1101249539 12:102918202-102918224 CTCAGTCTTCTCTAAAAGTGTGG - Intronic
1101799538 12:108008746-108008768 CTCTCTCCTCCCCAGAGGTGGGG + Intergenic
1103887974 12:124217053-124217075 CTCTGTCCTCTCAATACATGTGG + Intronic
1104138838 12:125967044-125967066 AACTGTCCTCTATAGAATTGTGG - Intergenic
1106087493 13:26557102-26557124 CTCTCTCCACCCTAGATGTGAGG - Intergenic
1106115467 13:26814180-26814202 ACCTGTACTTTCTAGAAGTGTGG - Intergenic
1106329600 13:28727307-28727329 CTGTGTCATATCTAGAATTGGGG + Intergenic
1107102629 13:36610448-36610470 CTCTGTGCTCTCAAGGATTGTGG + Intergenic
1108941659 13:55963459-55963481 ATCTTTCCTCTCTACAAGAGTGG - Intergenic
1109075954 13:57834695-57834717 CTTTTTCCTCTCTAAATGTGTGG + Intergenic
1109114081 13:58359070-58359092 CTCTGTCCTGTCTAGTTTTGTGG - Intergenic
1115160193 14:30385140-30385162 ATCTGTTCTCTCCAGAAGGGTGG + Intergenic
1120270813 14:82310587-82310609 CTGAGGCCTCTCTAGAAATGTGG + Intergenic
1121234563 14:92382955-92382977 CTCTTCCCTCTCCAGCAGTGAGG + Intronic
1121576399 14:94991926-94991948 CTCTGTCCTCTCAAGAGCAGAGG + Intergenic
1127635604 15:60866601-60866623 CTCTCTCCTCCCTAGAGGTCTGG - Intronic
1127729633 15:61787634-61787656 CTATCACCTCTCTAGTAGTGTGG + Intergenic
1128150149 15:65358035-65358057 CTTTTTTCTCTCTAGAAATGGGG - Intronic
1128474142 15:67982716-67982738 CTCTCTCCTGTCTAAATGTGAGG + Intergenic
1129348491 15:74939561-74939583 CTTTTTCCTCCCTAGCAGTGTGG + Intergenic
1131728043 15:95248919-95248941 CCCTTCCCTCCCTAGAAGTGGGG - Intergenic
1132570892 16:643401-643423 CCCTGCCCTCCCTAGCAGTGGGG - Intronic
1133874688 16:9722714-9722736 CTATGTGCTCTCTACCAGTGAGG - Intergenic
1134895977 16:17887060-17887082 CAGGGTCCTCTCTGGAAGTGGGG - Intergenic
1137831139 16:51544448-51544470 CTCTGTCCACACTAGCTGTGGGG + Intergenic
1138138781 16:54548292-54548314 CAGTGTCCTCTCTAGAAAAGAGG + Intergenic
1138170092 16:54840803-54840825 CTATCTGCCCTCTAGAAGTGTGG - Intergenic
1139656205 16:68388512-68388534 CACTGCCCTCTCTCTAAGTGGGG + Intronic
1139914305 16:70418772-70418794 TGCTGTCCTCCCTAGAAGAGGGG + Intronic
1139939004 16:70591355-70591377 CTCTGTCCTAGCTATAAGCGTGG - Intronic
1140047504 16:71451869-71451891 CACTTTCCTCTCTTGCAGTGAGG + Intronic
1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG + Intergenic
1141406393 16:83797469-83797491 CTCTGTCCTGATTAGAACTGTGG - Intronic
1142213779 16:88821163-88821185 CTCTGGCCTCTGGAAAAGTGAGG - Intronic
1142518300 17:447743-447765 CTCTGTCCTCGGGAGATGTGGGG - Intergenic
1143951307 17:10634729-10634751 CTCTGCCCTCACCAGCAGTGTGG - Intronic
1144046912 17:11462183-11462205 TTCTGTCCTCTCTGGGAGAGAGG + Intronic
1144890199 17:18490004-18490026 CTCTGGCCACTCAAGCAGTGGGG + Intronic
1145142017 17:20454314-20454336 CTCTGGCCACTCAAGCAGTGGGG - Intronic
1145728134 17:27152836-27152858 TTCTGTTCTTTCTAGAAGAGTGG + Intergenic
1145808694 17:27752138-27752160 CTCTGGCCACTCCAGTAGTGGGG + Intergenic
1145912434 17:28550424-28550446 CTCTGTCCTTAGAAGAAGTGAGG + Intronic
1147386292 17:40084290-40084312 CCCTGTCTCATCTAGAAGTGGGG - Intronic
1147424013 17:40337132-40337154 CTGTGTCCTCTGTGTAAGTGGGG - Intronic
1147907879 17:43834397-43834419 CTCTCTCCACTCAAAAAGTGTGG - Intergenic
1148081216 17:44968429-44968451 CTCTGGGCTCTCTAGGGGTGGGG + Intergenic
1151080702 17:71325345-71325367 CTCTCCCCTCTCTAGAGGTTGGG + Intergenic
1151518308 17:74611670-74611692 TTCTGTCCACTTTAGAAGTCTGG - Exonic
1153242894 18:3046611-3046633 TTCTGTCCTCTCTAGACATAGGG + Intergenic
1153875964 18:9371096-9371118 ATCTGTCATTTCTAAAAGTGAGG - Intronic
1155088151 18:22477451-22477473 CCCTGCCCTCTCCAGCAGTGGGG + Intergenic
1156712504 18:39963835-39963857 TTCTCTCCTCTTTAGAAGTTAGG + Intergenic
1157602784 18:48904510-48904532 CTCTGCCCTAACTAGAAGTATGG + Intergenic
1158527318 18:58226755-58226777 CTCTGTCAGCTGTAGCAGTGAGG - Intronic
1163098627 19:15079810-15079832 TTCTATCCTCTCTAGGAGTGAGG - Intergenic
1164944553 19:32282498-32282520 GTCTGTCTTCTCAAGAGGTGGGG - Intergenic
1168474601 19:56666811-56666833 CTCTGTCCTCTCTGCGTGTGAGG + Intronic
926681650 2:15668666-15668688 GTCTGTCCTGTCTGGGAGTGAGG + Intergenic
929960874 2:46495458-46495480 CTGTTTTCTCTCAAGAAGTGGGG - Intronic
929989143 2:46770100-46770122 CTGTGTCCTCTCTTGCAGTATGG + Intergenic
931496035 2:62808129-62808151 CTCTGAGCTCTCTAGATCTGTGG + Intronic
931956977 2:67438458-67438480 CCCAGTCCTCTCCAGGAGTGTGG + Intergenic
932067531 2:68581996-68582018 GTCTGTCTTCTCTAGAAGACAGG - Intronic
933857012 2:86424615-86424637 TTTTGTCATCTCTAGAAGTACGG - Intergenic
934091942 2:88558793-88558815 CTCTTTCCTCTCTAGACCTTTGG + Intronic
934719762 2:96565411-96565433 ATCTGTCCTCCCTAGGAGAGTGG + Intergenic
934810110 2:97270385-97270407 CTCTGTCAGCTCTAGAACTAAGG + Intergenic
934827582 2:97437554-97437576 CTCTGTCAGCTCTAGAACTAAGG - Intergenic
935268383 2:101413618-101413640 CTGTGTCCTCTGTAAAAGGGAGG - Intronic
937599237 2:123709886-123709908 CTCTGTCCCCTCTAGAAATTGGG + Intergenic
939092349 2:137794056-137794078 TTCTGTCTTCTCTAGTAGTTAGG - Intergenic
943444245 2:187963816-187963838 CTATGTCCTCTCTAATAATGAGG + Intergenic
945828250 2:214750766-214750788 CACTGTCATATCTAGAATTGTGG + Intronic
948702773 2:239770606-239770628 CTCTGTCCACTTTATAAGTGTGG + Intronic
1171935613 20:31272460-31272482 CTCACTCCTCTCCAGCAGTGGGG + Intergenic
1172815374 20:37682060-37682082 TTTTGTCCTCCCTAGAAGAGAGG - Intergenic
1173372756 20:42452459-42452481 CTCTGTTTTCTTGAGAAGTGGGG + Intronic
1173727698 20:45308649-45308671 CGCTGTCCCCTCCAGGAGTGAGG + Intronic
1175385937 20:58595106-58595128 CTCTTTCCTCTATGGAAGAGCGG - Intergenic
1175665751 20:60858272-60858294 ATCCGTCCTCTTTAGAGGTGTGG + Intergenic
1178133131 21:29595948-29595970 TTGTGTCCTCTTTAGAACTGTGG + Intronic
1178190736 21:30277172-30277194 CTCTGTTGTCTATAAAAGTGAGG + Intergenic
1179660532 21:42871930-42871952 CTCTGTCCTCTCTTCCAGTCAGG - Intronic
1180610156 22:17091027-17091049 GTCTGTGCTCTCTAGACCTGTGG + Intronic
1183347380 22:37315354-37315376 CTCTGTCCTCTCTGTGACTGCGG + Intergenic
1183722047 22:39568391-39568413 CTCTCTCCTCTGCGGAAGTGTGG + Intergenic
1183775107 22:39958980-39959002 CTCTGTGCTTTCTAGAATTTGGG - Intronic
1183872414 22:40749956-40749978 CTCTCTCCTCCCTGGAAGTTGGG + Intergenic
1183987150 22:41576063-41576085 CGATGTGCTCTCTAGAAGGGAGG - Exonic
1184390810 22:44202110-44202132 CTGTTTCCTCTGTGGAAGTGGGG - Intronic
950458334 3:13105802-13105824 CTCTGTCCCCTCTCCATGTGGGG + Intergenic
952659567 3:35828863-35828885 ATCTGTCCTCTCTACAGGTGAGG - Intergenic
953866339 3:46586442-46586464 GTCTGTCCCCTCTATAAATGCGG + Intronic
957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG + Intergenic
958055563 3:88406455-88406477 CTCTTATCTCTCTAGAAGTGAGG + Intergenic
959999868 3:112719907-112719929 CTCTGTTTTCTCTAGCAGTCTGG + Intergenic
966154613 3:176902448-176902470 CTCTGGCCTCTTTAGACTTGTGG - Intergenic
966285054 3:178285821-178285843 CAGTGTCCTCTCTAGGGGTGGGG - Intergenic
967465337 3:189798606-189798628 CTCTGTCCTCACCAGAGATGGGG + Intronic
969128408 4:4971895-4971917 CTCTGTCCTTTCTGGAGGTTGGG + Intergenic
969307319 4:6333293-6333315 CTCTTTCCTCCCTGGAATTGAGG + Intronic
970212131 4:13720740-13720762 CTCTCTCCTCACTGGAAGTTGGG + Intergenic
970733403 4:19136316-19136338 CTCTTTCCTCTTTAAATGTGAGG + Intergenic
974053014 4:56958863-56958885 CTCTGTGATCTGTGGAAGTGAGG + Intergenic
977718319 4:100209127-100209149 CTCTGTCCTCCCCAGAAGTCAGG - Intergenic
979230694 4:118346152-118346174 CTCTATCCTCTTCAGAAGCGTGG - Intronic
982326503 4:154134763-154134785 TTGTGTCCCCTCTTGAAGTGTGG - Intergenic
982361510 4:154524052-154524074 CTCTCTCCTCCCCACAAGTGAGG - Intergenic
985658872 5:1145755-1145777 CTCTGTCCTCTGCAGAAGGAAGG + Intergenic
989188127 5:38644199-38644221 CTCTTTCCTCTCTAGTAAGGTGG - Intergenic
994216852 5:97147362-97147384 CTCTGTTCTCTCTGGAAGATTGG - Intronic
995828303 5:116326230-116326252 CTCTGAGCTTTCTAGATGTGTGG - Intronic
999289555 5:150414836-150414858 CTCTCTCCTCTCTGGAAGTCGGG - Intergenic
1005184852 6:23153875-23153897 CTCTGTCCTCTCAAGATTGGAGG - Intergenic
1006952004 6:37830423-37830445 TTCTGTCTTTTCTTGAAGTGTGG + Intronic
1007412679 6:41674016-41674038 CTCTTTCCTTCCTAGCAGTGTGG + Intergenic
1007729186 6:43935436-43935458 CTCTCTCCTCTCTAGAGCTCAGG - Intergenic
1007741928 6:44016820-44016842 TTCTCTCCTCTCCAGAAGTTGGG - Intergenic
1007792460 6:44319072-44319094 CTCTGTCCTCTATAAAAATCTGG - Intronic
1010495675 6:76532096-76532118 CTCTTTCTTCTCTAAAAGTGTGG + Intergenic
1013168742 6:107617247-107617269 CGCTGCCCTCTTTAGAAGCGGGG - Intronic
1014474091 6:121851273-121851295 CTCTTCCCTCCCTAGCAGTGTGG + Intergenic
1014786151 6:125621818-125621840 CTCATTCCTCTCTAGAAGCAGGG - Intergenic
1015740288 6:136446533-136446555 CTCTCTCCTCCCCAGAAGTTGGG + Intronic
1017760513 6:157564330-157564352 CTCTTTCTTTTCCAGAAGTGGGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020829721 7:13079385-13079407 CTCTGTCCTCATGAGAAGTAGGG - Intergenic
1022157995 7:27679620-27679642 CTCTATCCTCTTTTGAAATGTGG - Intergenic
1026369736 7:69687060-69687082 CTATGTCTTCTTTAGCAGTGGGG + Intronic
1029668057 7:102008568-102008590 CTCTGCCCTCTCTAGAGATTGGG + Intronic
1029960637 7:104686389-104686411 GTCTGTCCTTTCTTGATGTGTGG - Intronic
1031936541 7:127741055-127741077 CTCTGTCTCCTCTGGAAGTAGGG + Intronic
1031992786 7:128208868-128208890 CCCTGGCCTCTTTAGAGGTGAGG - Intergenic
1032488185 7:132304264-132304286 CTGTGTCCTCTGTAGTAGGGAGG + Intronic
1032549613 7:132772114-132772136 ATCTGCCCTCCCTAGAAGTCTGG - Intergenic
1033063873 7:138134362-138134384 CTCTCCCCTCCCTAGAGGTGGGG - Intergenic
1033647897 7:143319102-143319124 CTCTGTCCTCTTCACATGTGGGG + Intronic
1038185183 8:25266812-25266834 CTATGTCTTCTCTAGAATTGTGG - Intronic
1039407261 8:37324055-37324077 GTCTGTCCCCTCTGGATGTGTGG - Intergenic
1039452202 8:37684160-37684182 CTCTGTCCTCTCTCTAAGCTGGG - Intergenic
1041044180 8:53876627-53876649 CTCTGTCCTTGCCAGAAGTTCGG + Intronic
1044904722 8:96989151-96989173 CTCTGCAGTCTCTAGAACTGAGG + Intronic
1045724635 8:105158206-105158228 CTCCGTCCTCTATTGATGTGAGG - Intronic
1052929785 9:34046996-34047018 CTCTGTCCTCCCTTTAAATGTGG - Intronic
1053105557 9:35405079-35405101 CTCTGACCTCCCAGGAAGTGTGG - Exonic
1054918994 9:70522946-70522968 CTCTCTCTTCCCTAGAGGTGGGG + Intergenic
1056101634 9:83305466-83305488 CTCTGTCATTTATAGCAGTGTGG - Intronic
1057438851 9:95067124-95067146 ATCTTTGCTCTCTAGAACTGTGG + Intronic
1057706699 9:97399864-97399886 CTCTGTCCGCACTAGCAGGGAGG + Intergenic
1057765123 9:97910006-97910028 CTGTGGCCACTTTAGAAGTGCGG - Exonic
1058966260 9:110041762-110041784 CTCTGTCCTTTCTTCAAGTAAGG + Intronic
1059779301 9:117509009-117509031 CTTTCTCCTCTCTGTAAGTGTGG + Intergenic
1062263926 9:135678208-135678230 CTCTCTCCTCACATGAAGTGTGG + Intergenic
1185546096 X:947084-947106 CTCTGTCCTCTCTAGACCTCTGG + Intergenic
1186051021 X:5595722-5595744 CTCTGTTCTCTTTACAAGTTTGG + Intergenic
1187618048 X:21020104-21020126 CTCTCTCCTCTCTAGAAGTGTGG - Intergenic
1188228649 X:27633455-27633477 CTGTGTCTTTTCTAGATGTGAGG + Intronic
1188445506 X:30249720-30249742 CTCTGTTCTCTCTACACCTGAGG - Intronic
1188516862 X:30997121-30997143 CTCTGTCCTCTTTATGACTGTGG + Intergenic
1189314829 X:40047695-40047717 CTCTGTCCTCTCAAAAAGCCTGG - Intergenic
1189655926 X:43245066-43245088 CTCTCGCCTCTCCAGAAGTAGGG + Intergenic
1190324479 X:49198710-49198732 CTACCTCCTCTCTTGAAGTGAGG - Intronic
1194006699 X:88503902-88503924 CTCTCTCCTCTCCTCAAGTGGGG - Intergenic
1195285549 X:103379038-103379060 CTTTGACCTCTATAGAATTGTGG + Intergenic
1195289594 X:103419551-103419573 CCCTTTCCTCTCTATGAGTGAGG + Intergenic
1200702178 Y:6411581-6411603 TTCTGTTCTTTCTAGAAGAGTGG + Intergenic
1200840341 Y:7775241-7775263 CTCTCTCTTCTGTAGAAATGAGG - Intergenic
1201031933 Y:9753117-9753139 TTCTGTTCTTTCTAGAAGAGTGG - Intergenic
1201530613 Y:14986578-14986600 CTCTGTCCTCTGGGGCAGTGTGG - Intergenic