ID: 922340479

View in Genome Browser
Species Human (GRCh38)
Location 1:224650932-224650954
Sequence GCGTGGACACTGGCTTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922340471_922340479 22 Left 922340471 1:224650887-224650909 CCTTGGGCAAGGGAAAATGAGCT 0: 1
1: 0
2: 0
3: 25
4: 228
Right 922340479 1:224650932-224650954 GCGTGGACACTGGCTTGATGGGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922340479 Original CRISPR GCGTGGACACTGGCTTGATG GGG Intronic
900642845 1:3695583-3695605 GAGTGGACACTGGCTCCATGGGG - Intronic
902216440 1:14937200-14937222 GCATAGACACAGGCTTGCTGAGG - Intronic
903318449 1:22526951-22526973 GCGTGGCCACTGGGTGGAGGGGG - Exonic
904541524 1:31236961-31236983 GCCTGGATCCTGGCTGGATGTGG + Intronic
905882549 1:41474212-41474234 CTGGGGACACTGGCTGGATGGGG - Intergenic
920199165 1:204248944-204248966 GCCTGGAAAGTGCCTTGATGGGG - Exonic
920504549 1:206507145-206507167 GCTTGGGAACTGGCTCGATGGGG - Intergenic
922340479 1:224650932-224650954 GCGTGGACACTGGCTTGATGGGG + Intronic
922551180 1:226495737-226495759 GTGTGGACACAGGCCTGGTGTGG - Intergenic
1065528646 10:26647372-26647394 GCGGGGCCACTGGCATGGTGGGG + Intergenic
1067216998 10:44311320-44311342 GCCTGCACACTTGCGTGATGGGG + Intergenic
1070421828 10:76245067-76245089 GGGTGGACACTGACCTCATGGGG - Intronic
1074138605 10:110650535-110650557 GCGTGGAAACTATCTTCATGGGG - Intronic
1077022881 11:427048-427070 GCGTGCACCATGGCTTGCTGTGG - Intronic
1081599586 11:44484019-44484041 GGTTTGACACTGGCTTGGTGGGG - Intergenic
1097161598 12:57050043-57050065 GAGTGGACACTGGCAAGAGGAGG - Exonic
1097883449 12:64706534-64706556 AGGTGAACACTGGCTGGATGAGG - Intergenic
1102433457 12:112901532-112901554 CCAGGGACATTGGCTTGATGAGG + Intergenic
1103979478 12:124727187-124727209 GCTGGGACACTGGCTGGATGAGG - Intergenic
1104933704 12:132353589-132353611 GCGTGCACACAGGCTTGGCGGGG - Intergenic
1105209224 13:18247988-18248010 GCGTGGGTACTGGCCTGCTGGGG - Intergenic
1116803075 14:49463843-49463865 GTGTGGTCAATGGCTTGATAAGG + Intergenic
1117341685 14:54797533-54797555 CCTTGTACACAGGCTTGATGAGG + Intergenic
1123777153 15:23591119-23591141 TTGTGGCCACTGGCCTGATGAGG + Intronic
1125758832 15:42083672-42083694 GCCTGGACTCTGCCTGGATGTGG - Intronic
1126347835 15:47715861-47715883 GGGTGGCCATTGGCTTGATGAGG - Intronic
1129875474 15:78972870-78972892 GTATCGACACTTGCTTGATGTGG - Intronic
1133262366 16:4559250-4559272 GAGGGGAAACTGGCTGGATGTGG + Intronic
1134246602 16:12544848-12544870 GTGTTGACACTGGCTGCATGTGG - Intronic
1134610796 16:15606465-15606487 GAGTGGAGAGTGGCTTGATCAGG - Intronic
1136397979 16:30003392-30003414 GCCTGGACAGTGGCCTGAAGTGG + Intronic
1141754813 16:85983924-85983946 GGGTGGTCACAGGCATGATGGGG + Intergenic
1142328569 16:89434816-89434838 GCGAGGACACTGGCTGTCTGGGG + Intronic
1144938439 17:18918735-18918757 GGGTGGCCACTGGCTACATGTGG + Intronic
1148774978 17:50090180-50090202 GCGTGGGGTCTGGCTGGATGGGG - Intronic
1156397774 18:36714944-36714966 GGGTGGGCCCTGGCTTGAGGAGG - Intronic
1159943731 18:74428174-74428196 GTGTGCACACTGGCTTGGTTGGG - Intergenic
1166875938 19:45897351-45897373 GCATGGACTCTGGCCTGGTGTGG - Intronic
1167116989 19:47494046-47494068 GCCTGGACACTGGGTGGAGGCGG - Intronic
1167570832 19:50288052-50288074 GCTGGGACACTGGCTGGGTGAGG - Intronic
936250024 2:110861197-110861219 GTGTGGAAACTGGTTTGATTTGG - Intronic
938671145 2:133588222-133588244 GCTTGGATTCTGGCTTAATGGGG + Intergenic
944351655 2:198734523-198734545 GTGGGGACACTTGCTTGAGGTGG + Intergenic
946252620 2:218422827-218422849 GGGTGGCCTCTGGCCTGATGAGG + Intronic
1171290394 20:23979701-23979723 GCGTGGGTACTGGCCTGCTGGGG - Intergenic
1172808138 20:37627802-37627824 GTGTGGATACAGGGTTGATGGGG + Intergenic
1179450889 21:41467569-41467591 GGGTGGACACTGGGGGGATGGGG + Intronic
1180676466 22:17589876-17589898 CCTTGGAAACAGGCTTGATGTGG - Intronic
1180767033 22:18351309-18351331 GCGTGGGTACTGGCCTGCTGGGG + Intergenic
1180779280 22:18511070-18511092 GCGTGGGTACTGGCCTGCTGGGG - Intergenic
1180811997 22:18768390-18768412 GCGTGGGTACTGGCCTGCTGGGG - Intergenic
1180835320 22:18926777-18926799 CCGTGGTCACTGACTTGATCAGG - Intronic
1181198152 22:21202634-21202656 GCGTGGGTACTGGCCTGCTGGGG - Intergenic
1181401592 22:22653170-22653192 GCGTGGGTACTGGCCTGCTGGGG + Intergenic
1181647960 22:24243947-24243969 GCGTGGGTACTGGCCTGCTGGGG - Intronic
1185260229 22:49857444-49857466 GCGTGGTCGCTGGCTTGCTCTGG + Intronic
1203228655 22_KI270731v1_random:92203-92225 GCGTGGGTACTGGCCTGCTGGGG + Intergenic
1203285408 22_KI270734v1_random:152076-152098 CCGTGGTCACTGACTTGATCAGG - Intergenic
950573178 3:13814689-13814711 GCTTGGAGGCTGGCTTGATGGGG + Intergenic
956449664 3:69361215-69361237 ACTTGGAAACTGGCTTGAAGAGG - Intronic
956456002 3:69421063-69421085 GGGTGGACACTGGGTGGGTGAGG - Intronic
957127367 3:76179237-76179259 GTGTGGTCACTGGCTTCATGGGG + Intronic
962888695 3:139652138-139652160 GCCTGGGCACTGGCTGGCTGAGG - Intronic
969279498 4:6160681-6160703 GCGTGGAGGCTGGCCTGTTGGGG - Intronic
975333470 4:73147369-73147391 GCCTTGACTCTGGCTTGCTGTGG - Exonic
979014646 4:115418453-115418475 GCATGTACACTGGATGGATGGGG + Intergenic
984768684 4:183419352-183419374 ACCTGGGCCCTGGCTTGATGTGG + Intergenic
997859626 5:137404758-137404780 GGGTTAACTCTGGCTTGATGTGG - Intronic
1001240666 5:170067608-170067630 GCATGGAGAGTGGGTTGATGGGG - Exonic
1002389687 5:178900293-178900315 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389709 5:178900387-178900409 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389721 5:178900434-178900456 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389744 5:178900528-178900550 ACGAGGACACTGGCTGGCTGGGG - Intronic
1003625861 6:7740750-7740772 GCCTGGCAACTGACTTGATGTGG - Intronic
1006301833 6:33197766-33197788 GCCTGGCCACTGGCATGAAGAGG - Exonic
1006905855 6:37533031-37533053 GCAAGGACACTGGAGTGATGGGG + Intergenic
1007191645 6:40023710-40023732 GGGTGTACCCTGGCTTGTTGCGG + Intergenic
1009308696 6:62122746-62122768 GAGTGGACACTGGCTAAAAGGGG - Intronic
1010752459 6:79631071-79631093 GCAAGGATCCTGGCTTGATGAGG - Intergenic
1016129343 6:140446547-140446569 ACTTGGACAGTGGATTGATGGGG + Intergenic
1017048289 6:150367385-150367407 GTGTGGAAACTGGATAGATGGGG - Intergenic
1019580314 7:1758652-1758674 GGGTGGAGACTGGCTGGCTGAGG + Intergenic
1022125577 7:27353134-27353156 GGGTGGACCCTGGTTTGCTGAGG - Intergenic
1024600288 7:50974397-50974419 GCGTGGACAGCAGGTTGATGTGG + Intergenic
1026915843 7:74120063-74120085 GGGTGGAGACTGGAGTGATGCGG - Intronic
1035677658 8:1466754-1466776 GCGTGGATAGTGGTGTGATGTGG + Intergenic
1035908123 8:3536017-3536039 GCGTGGTCGCTGGCTTGAGGAGG - Intronic
1037100218 8:15033890-15033912 GCCTGCATGCTGGCTTGATGTGG - Intronic
1037707734 8:21329830-21329852 GGATGGAGACTGGCTTGAAGAGG - Intergenic
1039429070 8:37511615-37511637 CCGTGGACACTGCTTGGATGAGG - Intergenic
1043960720 8:86415239-86415261 GTGGGGAAACTGGCTTGATTTGG - Intronic
1046874704 8:119241197-119241219 TGGTGGCCACTGGCTTCATGTGG + Intronic
1047246980 8:123154692-123154714 GCATGGACACTGGCATGTTCCGG - Intergenic
1049224653 8:141444440-141444462 GGGTGGAGACTGGCTGGAGGAGG + Intergenic
1049291480 8:141805261-141805283 GGGTGGACACGGGCTTGGAGTGG - Intergenic
1049700025 8:144006456-144006478 GGGTGGGCACTGGTCTGATGAGG + Intronic
1051343646 9:16133400-16133422 GCCTAGACACTGGCATCATGGGG + Intergenic
1052250656 9:26393838-26393860 GCGTGGAAACTGACCTGGTGAGG - Intergenic
1052437236 9:28444477-28444499 GCGTGGTGAATGGGTTGATGGGG - Intronic
1056828788 9:89897100-89897122 ACCTGGACACTGCCTTGGTGAGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060040639 9:120297368-120297390 GTGTGGAAACTGGCTCTATGTGG - Intergenic
1060059805 9:120448953-120448975 GCGTGGACAGTGGCTTAGAGAGG - Intronic
1061986481 9:134133000-134133022 AAGTGGACACTGGCTGGTTGGGG + Intergenic
1062042514 9:134410656-134410678 GCGTGGAGACTGGCCTGTTCTGG + Intronic
1187001684 X:15187048-15187070 GCGTGGAAGCTAGCTTGAAGGGG + Intergenic
1187801045 X:23063189-23063211 GCATGGAGAATGGATTGATGAGG - Intergenic
1192240277 X:69322945-69322967 GGGTGGACCCTGGTTGGATGGGG + Intergenic