ID: 922342969

View in Genome Browser
Species Human (GRCh38)
Location 1:224672240-224672262
Sequence ATACACCTCCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922342969_922342974 27 Left 922342969 1:224672240-224672262 CCTGCTTCCCTGGGGAGGTGTAT 0: 1
1: 0
2: 2
3: 23
4: 250
Right 922342974 1:224672290-224672312 TCTTTCATGCTAACATTTTCAGG 0: 1
1: 0
2: 4
3: 28
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922342969 Original CRISPR ATACACCTCCCCAGGGAAGC AGG (reversed) Intronic
900118789 1:1039949-1039971 TTGCACTTCTCCAGGGAAGCTGG + Intronic
900977313 1:6025771-6025793 GTACCCCTTCCCAGGGCAGCAGG + Intronic
902386652 1:16079715-16079737 AGAGCCCTCCCCAGGAAAGCAGG + Intergenic
902817325 1:18923798-18923820 AGACAGCTCCCCAGTGATGCTGG + Intronic
902899217 1:19502639-19502661 ATAAAACTCCTCAGGAAAGCTGG + Intergenic
903057234 1:20644707-20644729 ATACATCTCCCAAGGGGAGCTGG + Intronic
904998847 1:34652401-34652423 AGACAATTCCACAGGGAAGCTGG - Intergenic
905810146 1:40906712-40906734 ATACACCTCCTCTGGGAAGTGGG - Intergenic
906159852 1:43640033-43640055 AGCCCCCTCCCCAGGGAACCAGG + Intergenic
906556966 1:46721753-46721775 ATACAGGTTCCCAGGGAACCAGG + Intergenic
906578899 1:46917960-46917982 ATACAGGTCACCAGGGAAGTGGG + Intergenic
906594441 1:47062576-47062598 ATACAGGTCACCAGGGAAGTGGG - Intergenic
907633330 1:56106784-56106806 ATACAGGTCACCAGGGAAGTGGG - Intergenic
909999625 1:82326938-82326960 ATACTGGTCCCCAGGCAAGCAGG - Intergenic
911806197 1:102211228-102211250 ATACAGGTCGCCAGGGAAGTGGG + Intergenic
912798114 1:112705073-112705095 GTTCCCCTCCCCAGGGAAGGAGG - Intronic
913689250 1:121262971-121262993 ACACACCTGCCCAGGGAACCTGG + Intronic
914148349 1:145017309-145017331 ACACACCTGCCCAGGGAACCTGG - Intronic
918073342 1:181150114-181150136 AAACCACTCCCCAGGGAACCAGG - Intergenic
919281633 1:195496499-195496521 ATACAGTTCACCAGGGAAGTGGG + Intergenic
920100441 1:203513933-203513955 AAACACGTCCCCAAGGAAGAAGG + Intergenic
920476573 1:206281446-206281468 ACACACCTGCCCAGGGAACCTGG + Intronic
920500718 1:206483323-206483345 ATACATCTCCACAGGGAGTCAGG - Intronic
920989746 1:210925610-210925632 ATACAGGTCACCAGGGAAGTAGG - Intronic
921116678 1:212098665-212098687 ATACACATCACCAGGGAAATAGG + Intronic
921621839 1:217334103-217334125 ATAGACCCCACCAGGGAGGCTGG + Intergenic
921968224 1:221116283-221116305 CTGCTCCTCCCCAGGAAAGCAGG - Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922872438 1:228914027-228914049 AGGCCCCTCCCCAGGGTAGCTGG - Intergenic
923337412 1:232982562-232982584 ATGAACCTCCCCAGAGAAACGGG + Exonic
923656412 1:235920877-235920899 ATCCCCCTCCCCAGGGATTCAGG - Intergenic
1062902382 10:1156157-1156179 CTCCACATCCCCAGGGTAGCTGG - Intergenic
1062966964 10:1615330-1615352 CTGCCCCTCCCCAGAGAAGCTGG + Intronic
1063962474 10:11318428-11318450 TGCCACCTCCCCAGGGAAACAGG + Intronic
1064628040 10:17281753-17281775 AGACACCTTCACAGGGCAGCAGG - Intergenic
1064808716 10:19167848-19167870 AACCACCTCCCCATGAAAGCAGG + Intronic
1064911676 10:20408540-20408562 ATCCACCTCCCAAGGGAAAAAGG + Intergenic
1067744347 10:48924128-48924150 CTTCACCTCCCCAGGGAGTCTGG + Intronic
1069129591 10:64682213-64682235 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1069550828 10:69362840-69362862 ATGACCCTCCCCAGAGAAGCCGG - Intronic
1069648099 10:70019525-70019547 ATACAGGTCGCCAGGGAAGTGGG - Intergenic
1070162956 10:73876635-73876657 CTACCCCTCCCCAGGGCAACAGG + Intergenic
1070558844 10:77550620-77550642 ATGCCTCTCCCCAGGGAACCAGG + Intronic
1070615308 10:77965240-77965262 ATATACCTCCACACGAAAGCTGG - Intergenic
1070683605 10:78465875-78465897 ACCTAACTCCCCAGGGAAGCAGG - Intergenic
1073133298 10:101204753-101204775 AGACACTTCCTCAGGGATGCGGG - Intergenic
1075288213 10:121205229-121205251 TCATACCACCCCAGGGAAGCAGG + Intergenic
1076306393 10:129468184-129468206 AGACACCTGCCCAGGGATGGGGG - Intronic
1076637336 10:131891099-131891121 ATATGCGTCCCCAGGGAAGTTGG - Intergenic
1076918682 10:133440244-133440266 ATGCACCACCCCGGGGCAGCCGG + Intergenic
1077103285 11:831522-831544 ATTCAGCTCCCTAGGGAAGGAGG - Exonic
1077915743 11:6610664-6610686 ATGCACCTCCCCAAAGCAGCAGG + Exonic
1078186969 11:9060380-9060402 CTTCACCTCCCCAGGGAGACTGG - Intronic
1078451522 11:11444103-11444125 ACAACTCTCCCCAGGGAAGCCGG + Intronic
1080450434 11:32374692-32374714 ACAGCCCTCCCCAGGGAGGCAGG - Intergenic
1086952971 11:92909597-92909619 ATAGACCACCCCAGGGAGTCAGG + Intergenic
1087602056 11:100329163-100329185 ATACAGGTCACCAGGGAAGTAGG - Intronic
1087630780 11:100648004-100648026 ATACAGGTCTCCAGGGAAGTGGG - Intergenic
1087800203 11:102495639-102495661 ATACACCTCCTCCTTGAAGCCGG - Intronic
1092602523 12:10082417-10082439 ATACAGGTCACCAGGGAAGTGGG - Intronic
1093758217 12:22876293-22876315 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1094503196 12:31038298-31038320 ATACACCTTCCCAGTGATGGAGG - Intergenic
1097605975 12:61754906-61754928 TGCCACCTGCCCAGGGAAGCAGG + Exonic
1098074097 12:66708269-66708291 ACACAGCTCCCCAAGGAATCAGG + Intronic
1099041973 12:77667486-77667508 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
1100937026 12:99680880-99680902 ATACAGGTCACCAGGGAAGTGGG - Intronic
1101323798 12:103697109-103697131 TCCCACCTCCTCAGGGAAGCTGG + Intronic
1101405576 12:104425864-104425886 ACAGAACTACCCAGGGAAGCTGG + Intergenic
1101780950 12:107834823-107834845 ATTCATCTCCCCAGGTAAACTGG - Intergenic
1102459346 12:113090605-113090627 ACACAGCTCCCGAGGGAGGCAGG - Intronic
1103944298 12:124517681-124517703 ATGCTCCCCCCCAGGGACGCCGG + Intronic
1104639664 12:130459403-130459425 AGACACCACCACCGGGAAGCAGG + Intronic
1104717124 12:131023438-131023460 ACCCACTTCCCCAGGTAAGCCGG + Intronic
1104728364 12:131091866-131091888 AAACACCACCCCTGGGTAGCAGG - Intronic
1106479002 13:30123018-30123040 ACGAACCTCCCCAGGGAAGCGGG - Intergenic
1108751045 13:53448660-53448682 ATACCCCTCCCCAGACAAACTGG - Intergenic
1109484571 13:63001940-63001962 ACACAGGTCCCCAGGGAAGTGGG - Intergenic
1109924633 13:69120174-69120196 ATACAGGTCACCAGGGAAGTGGG - Intergenic
1110336998 13:74344936-74344958 ATATGCCACCCCAGGGAAGAAGG - Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1113560033 13:111271337-111271359 ATCCACCTTCCCCGGGAAGATGG - Intronic
1113566276 13:111321499-111321521 TTGCACCTCCCCCGGGAGGCAGG + Intronic
1114336948 14:21699951-21699973 ATACAGGTCACCAGGGAAGTGGG - Intergenic
1114619423 14:24086275-24086297 ACATGCCTCCCCAGGGAAGCTGG - Intronic
1115393245 14:32877486-32877508 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1116063885 14:39958303-39958325 ATACAGGTCACCAGGGAAGTGGG - Intergenic
1116669051 14:47817652-47817674 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1119582705 14:75801284-75801306 ATACAGGTCACCAGGGAAGTAGG + Intronic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1120924608 14:89785183-89785205 ACACTGGTCCCCAGGGAAGCTGG + Intergenic
1124983585 15:34584456-34584478 ACACACATCCCCAGGAGAGCCGG + Intronic
1127855419 15:62949923-62949945 TTACTCCTCCCCAGGTAAGAAGG + Intergenic
1129408025 15:75332207-75332229 ATACCTCTTCCCAGGGCAGCAGG + Intergenic
1130115268 15:81000808-81000830 CTGCTCCTCCCCCGGGAAGCTGG - Intergenic
1130585621 15:85179185-85179207 TTACAACTTCCCTGGGAAGCAGG + Intergenic
1133543867 16:6786191-6786213 ATACCCCTCCCCAAGGAATGAGG - Intronic
1137339483 16:47586112-47586134 AAACAAGTCCCCAGGGAAGTTGG - Intronic
1142410545 16:89913748-89913770 GTACAGCTCCCCAGGACAGCTGG - Intronic
1142424083 16:89991598-89991620 GTCCCCCTCCCCAGAGAAGCAGG - Intergenic
1142803291 17:2358271-2358293 AGACACGTCCCCGGGGAAGGAGG + Intronic
1142940472 17:3376546-3376568 ATACATATCACCAGGGAAGTGGG + Intergenic
1145818115 17:27810234-27810256 ATGCAGGTCCTCAGGGAAGCAGG - Intronic
1146157318 17:30535351-30535373 ACACACCTGCCCAGGGGAGAAGG - Intergenic
1146287134 17:31581585-31581607 ACCCAGCTCCCCAGGGAACCTGG - Intergenic
1149249558 17:54752778-54752800 ATACACCTCCCCACTTAAACGGG + Intergenic
1150528639 17:65953690-65953712 ATACAGGTCACCAGGGAAGTAGG - Intronic
1151364128 17:73606253-73606275 AGGCAGCTCCCTAGGGAAGCTGG + Intronic
1152045098 17:77930263-77930285 AAACACATCACCAGGGCAGCAGG + Intergenic
1152533962 17:80939855-80939877 AAACGCCTCCCCAGGGAATGGGG - Intronic
1153424970 18:4952920-4952942 ATACAGATCACCAGGGAAGTGGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1154254235 18:12768692-12768714 ACAGAGCTCCCCAGGGATGCTGG - Intergenic
1157685745 18:49640989-49641011 ACCCACCTCCCCAGGAATGCCGG - Intergenic
1158727203 18:59984355-59984377 AGACACTTCCCCAGGGGAGGTGG - Intergenic
1159937861 18:74382890-74382912 CTGCACCTCCCCAGGGGAGTGGG - Intergenic
1160154227 18:76421272-76421294 ATAAACCTCCCAAGAGGAGCAGG + Intronic
1162496742 19:11027569-11027591 ATACGCCTCCCCAGCGAGGGTGG + Intronic
1166234062 19:41443096-41443118 ACACAGCTCCCCAGGGGACCAGG + Intergenic
1167377173 19:49118481-49118503 AGACACCAACCCAGGGATGCAGG - Exonic
925904170 2:8529434-8529456 AGACGCCTCCCCAGGAAAGAAGG - Intergenic
926331595 2:11830115-11830137 AGACACCTTCCCAGGGATGTGGG + Intergenic
927036735 2:19185226-19185248 ATACAGCTCACCAGGGAAGTGGG + Intergenic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
928472709 2:31589998-31590020 ATACATGTCACCAGGGAAGCGGG - Intergenic
929739217 2:44585447-44585469 ATATAACCCCCCAGAGAAGCAGG - Intronic
931715030 2:65022024-65022046 TCACACCTCCCCAGGGAAGGAGG - Exonic
932346518 2:70999342-70999364 AAACATCTTCCCAGGGAAGGAGG + Intergenic
932363257 2:71128361-71128383 ATACACACCCCCAAAGAAGCGGG + Intronic
932475343 2:72002481-72002503 TTTCAACACCCCAGGGAAGCAGG - Intergenic
933001739 2:76933390-76933412 ATATACCTCTGCAGGCAAGCAGG - Intronic
934885969 2:98025296-98025318 CCACCCCACCCCAGGGAAGCTGG + Intergenic
937699453 2:124847369-124847391 ATACAGGTCACCAGGGAAGTGGG + Intronic
937970719 2:127546745-127546767 ATGGACCTACCCAGGAAAGCAGG - Intronic
938656941 2:133443912-133443934 ATACTCCTGCCCAGGGCAACTGG + Intronic
938854889 2:135299262-135299284 ATACAGGTCTCCAGGGAAGTGGG + Intronic
939029480 2:137054512-137054534 ATATACATCCCCAGAGAAGCAGG - Intronic
939149453 2:138456022-138456044 ATACAGATCACCAGGGAAGTAGG - Intergenic
940423752 2:153508472-153508494 ATACAGGTCACCAGGGAAGTGGG + Intergenic
942749593 2:179272804-179272826 ACACACCTCTCCAGGGCAGCTGG - Intergenic
945175510 2:207039462-207039484 AAACACCTGCCCAGACAAGCAGG + Intergenic
948511143 2:238466135-238466157 AAACCCCTTCCCAGGGATGCTGG - Intergenic
948819253 2:240530226-240530248 ATGCGCCTCCCCTGGGCAGCAGG - Intronic
1170585790 20:17732927-17732949 ACCCTGCTCCCCAGGGAAGCTGG - Intronic
1171378654 20:24714905-24714927 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1172329266 20:34063634-34063656 ATGCATCTATCCAGGGAAGCAGG + Intronic
1172387940 20:34547146-34547168 ATACACTTCCCTGGGGACGCGGG + Intronic
1173823046 20:46030892-46030914 ATCCACCTCCCCAGTGACCCTGG + Intronic
1175258036 20:57658593-57658615 ATCCACCTCCCCAGAGATTCAGG - Intronic
1175767818 20:61603376-61603398 ACCCAGCTCCCTAGGGAAGCTGG + Intronic
1175810989 20:61857133-61857155 ATACCCCTCCCCGGGGCAGAGGG + Intronic
1176263251 20:64194419-64194441 GTACATCACCCCAGGGAGGCAGG - Intronic
1177364555 21:20117355-20117377 ATACAAGTCACCAGGGAAGTGGG + Intergenic
1179148931 21:38794032-38794054 ATACACCAGCCCAGGGACGGAGG + Intergenic
1180005875 21:45020272-45020294 AGACACCTCCACTGGGGAGCAGG - Intergenic
1203295815 22_KI270736v1_random:42281-42303 TTTCAGCTCCACAGGGAAGCTGG + Intergenic
949258384 3:2077758-2077780 ATCCACCTCCCCAGGGAAAGGGG + Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949789988 3:7782266-7782288 AGACACGTCCCCAGGCAAGAAGG + Intergenic
950566628 3:13773202-13773224 ACCCAGCTCCCCAGGAAAGCAGG - Intergenic
950587915 3:13909250-13909272 ATACAGTTCACCAGGGAAGTTGG - Intergenic
951727308 3:25774548-25774570 ATACAGGTCACCAGGGAAGTGGG + Intronic
952082854 3:29781870-29781892 ATACAGGTCACCAGGGAAGTGGG - Intronic
952183250 3:30941693-30941715 ATACAGATCACCAGGGAAGTGGG + Intergenic
953385089 3:42501863-42501885 GGGCACCTCCCCAGGGAGGCTGG - Intronic
954517494 3:51191530-51191552 ATACACCACCACTGGGAACCTGG - Intronic
954619405 3:51986974-51986996 CTACACCTCCCCAGGGGTGCGGG + Exonic
956666614 3:71648344-71648366 ATACACCACGCCAAGGTAGCGGG - Intergenic
956791432 3:72683137-72683159 GTTCATCTCCCCAGGGAAGGAGG - Intergenic
960557136 3:119042503-119042525 ATACAGGTCACCAGGGAAGTGGG - Intronic
961770759 3:129248378-129248400 CTTCCCCTCCCCAGGCAAGCTGG + Intergenic
961930557 3:130528792-130528814 AAAAAGCTCCCCAGGTAAGCCGG + Intergenic
962709400 3:138072903-138072925 ATACAGGTCGCCAGGGAAGTGGG - Intronic
962928159 3:140013923-140013945 CTGCAACTCCCCAGGGAATCTGG + Intronic
963061325 3:141229570-141229592 ATAGACATCCTCAGGGAATCGGG + Intronic
964324975 3:155535514-155535536 ATACAGGTCACCAGGGAAGTGGG - Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
968932114 4:3586648-3586670 ATACACCACAGCAGGAAAGCTGG - Intronic
969429462 4:7145704-7145726 TTTCACCTCCCTCGGGAAGCAGG + Intergenic
969611992 4:8232592-8232614 AAACCCTGCCCCAGGGAAGCAGG - Intronic
969621344 4:8280405-8280427 CCAAACCTCACCAGGGAAGCAGG + Intronic
971472324 4:27040395-27040417 ATACAGGTCGCCAGGGAAGTGGG + Intergenic
972806447 4:42533386-42533408 ACACACATCACCAGGGAAGTGGG - Intronic
973718836 4:53703147-53703169 TTTCCCCTCCCCAGGGAGGCAGG + Intronic
973920185 4:55676101-55676123 ATCCCCATCCCTAGGGAAGCGGG + Intergenic
975923533 4:79421689-79421711 ATGCATCACCCCATGGAAGCTGG + Intergenic
977777516 4:100938855-100938877 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
978201978 4:106032943-106032965 ATACAGGTCACCAGGGAAGTGGG + Intergenic
978470865 4:109066022-109066044 ATGCACCACCCCAGGGCAGGTGG - Intronic
979356971 4:119715858-119715880 ATACAGGTCACCAGGGAAGTGGG - Intergenic
979578539 4:122325889-122325911 ATACCCTTCCCCAGGACAGCTGG - Intronic
979584861 4:122403931-122403953 ATACATGTCACCAGGGAAGTTGG + Intronic
981442561 4:144799530-144799552 ATACAGGTCACCAGGGAAGTGGG + Intergenic
981831503 4:149007125-149007147 CTCCACCTCCCCATGGAAGGAGG - Intergenic
982660333 4:158199222-158199244 CTGCAGCTCCCCAAGGAAGCAGG - Intergenic
985016408 4:185639391-185639413 AGAAACCTCTGCAGGGAAGCAGG - Intronic
985108339 4:186520935-186520957 ATACAAGTCGCCAGGGAAGTTGG + Intronic
985118416 4:186615504-186615526 ATAGACCTGCCCAGGGAAGAAGG - Intronic
985355737 4:189116891-189116913 GTACAGGTCCCCAGGGAAGTGGG - Intergenic
986460346 5:7963914-7963936 CTACACCTGCCATGGGAAGCTGG - Intergenic
987265329 5:16247393-16247415 ATCCACCTCCCCAGGGATGATGG + Intergenic
987440623 5:17951784-17951806 ATGCAGGTCGCCAGGGAAGCAGG + Intergenic
987901893 5:24023348-24023370 ATACAGGTCACCAGGGAAGTAGG - Intronic
988725208 5:33919935-33919957 ATACAGGTCACCAGGGAAGTGGG + Intergenic
989345934 5:40429435-40429457 AAACACCTACCCAGGGCACCAGG + Intergenic
989431570 5:41361159-41361181 ATACAGGTCACCAGGGAAGTGGG + Intronic
994139804 5:96329525-96329547 CTGCAGCTCCCCAGGGAAACTGG - Intergenic
994871009 5:105350714-105350736 ATACAGGTCGCCAGGGAAGTGGG + Intergenic
996875386 5:128235236-128235258 ATACAGGTCACCAGGGAAGTGGG + Intergenic
996884714 5:128341547-128341569 ATACAGCTGCCCAGGGAATGGGG - Intronic
997828035 5:137124959-137124981 ATGAAACTCCCCAGGGAAACTGG - Intronic
1000394619 5:160760752-160760774 ATACAGGTCTCCAGGGAAGTGGG - Intronic
1001983312 5:176051944-176051966 CAACACCTCGCCTGGGAAGCGGG + Intronic
1002234153 5:177792108-177792130 CAACACCTCGCCTGGGAAGCGGG - Intronic
1002924054 6:1594730-1594752 AGGCACCTCGCCATGGAAGCTGG + Intergenic
1004619824 6:17322720-17322742 ACACACCTCCCAACTGAAGCAGG - Intergenic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1005825835 6:29631566-29631588 ATACACCCGCCCTGGGAAGGGGG - Exonic
1006439376 6:34043636-34043658 ACACACCTCCCCCAGGAGGCTGG + Intronic
1007630542 6:43270736-43270758 ATCCACCTCCCAAGGCAGGCTGG + Intronic
1010027795 6:71239892-71239914 ATACAGGTCACCAGGGAAGTGGG - Intergenic
1010518487 6:76803344-76803366 ATACAGGTCCCCAGGGAAGTGGG + Intergenic
1010975897 6:82313243-82313265 ATACAGGTCACCAGGGAAGTTGG - Intergenic
1011156645 6:84340908-84340930 ATGCAGGTCACCAGGGAAGCTGG + Intergenic
1013612678 6:111809656-111809678 CCACACCTCCCCAGTGAAGAGGG - Intronic
1015551292 6:134414791-134414813 AGACACCTCCCCAGAGAACCAGG + Intergenic
1016473306 6:144398143-144398165 GTACACCACCCCAGGGAACAGGG - Intronic
1017958925 6:159204926-159204948 CTTCATCCCCCCAGGGAAGCAGG - Intronic
1018989615 6:168663506-168663528 ATTCAGCTCTCCAGGGAAGGTGG + Intronic
1019290713 7:248744-248766 ATTCACCTCCCCAGGTAGCCTGG + Intronic
1022272454 7:28822601-28822623 ATAGACGTTCCCAGGGAGGCTGG - Exonic
1027050782 7:75019963-75019985 TCACACCAGCCCAGGGAAGCTGG - Intronic
1027556119 7:79666794-79666816 ATTTACCTCTCCAGGAAAGCTGG - Intergenic
1031261351 7:119525035-119525057 ATACAGGTCACCAGGGAAGTAGG - Intergenic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1033816741 7:145082885-145082907 ATACATGTCACCAGGGAAGTGGG + Intergenic
1034267790 7:149789610-149789632 GGACACCTCCCCGGGGACGCAGG - Intergenic
1035534933 8:383755-383777 CTACACCTCCCAAAGGAGGCTGG - Intergenic
1036244359 8:7103771-7103793 ATGCACTTCCCCAGCTAAGCCGG - Intergenic
1036256385 8:7209968-7209990 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036308435 8:7668553-7668575 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036361100 8:8077524-8077546 ATGCACTTCCCCAGGTCAGCTGG - Intergenic
1036776564 8:11616991-11617013 GTACAGCCCCCCAGGGAATCTGG - Intergenic
1037308457 8:17530052-17530074 ATTCACCTGCCAAGAGAAGCCGG - Intronic
1038053063 8:23831443-23831465 ATACACCACCCCAGGGAGGAAGG - Intergenic
1039412070 8:37363237-37363259 GTGCACCTCTCCAGGGAGGCAGG + Intergenic
1039642345 8:39237613-39237635 ATACAGGTCACCAGGGAAGTGGG - Intronic
1043556777 8:81439351-81439373 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1043991628 8:86762709-86762731 ATTCATCTCCCCAGGGAACTTGG + Intergenic
1045671039 8:104553475-104553497 ATACAGGTCGCCAGGGAAGTGGG - Intronic
1047254516 8:123205742-123205764 ATAGACCTCCCGAGAGCAGCAGG - Intronic
1047489469 8:125362724-125362746 ATAGCCCTCCCAAGGGGAGCTGG - Intronic
1047890450 8:129303003-129303025 ATACAGGTCACCAGGGAAGTGGG + Intergenic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1048781822 8:138010109-138010131 ATATACCTTCTCAGGGGAGCTGG - Intergenic
1051370669 9:16356347-16356369 GCACACCGCGCCAGGGAAGCAGG + Intergenic
1052240149 9:26261928-26261950 ATCCACCTCCCCAAGGATTCTGG + Intergenic
1053242631 9:36508460-36508482 GTTCAACTCCCAAGGGAAGCGGG + Intergenic
1055244238 9:74220683-74220705 ATACAGGTCACCAGGGAAGTAGG - Intergenic
1057475694 9:95399362-95399384 ATACAGGTCGCCAGGGAAGTGGG - Intergenic
1059673767 9:116516852-116516874 ATACAGGTCACCAGGGAAGTAGG - Intronic
1060281032 9:122215856-122215878 ATACTCCTCCCCAGAAAAACTGG + Intronic
1060406619 9:123376074-123376096 AGCCACCTCCCCAGGGCAGGGGG + Intronic
1061153835 9:128845325-128845347 ACACACCTCCCCAGCCCAGCTGG + Intronic
1061985439 9:134127645-134127667 AAACACCACTCCAGGGATGCGGG + Intergenic
1185699328 X:2218578-2218600 ATTCACCTCCCTAGTGTAGCTGG - Intergenic
1185748918 X:2594736-2594758 CTGCACCTGCCCAGGGACGCTGG + Intergenic
1186283342 X:8017988-8018010 GTACTCCTCCCCAGGGATCCAGG + Intergenic
1189328934 X:40130916-40130938 AGCCAGCTCCCCAGGGAAGGTGG - Intronic
1189685479 X:43559787-43559809 TCACACCTCCCCAGGGGAGGTGG - Intergenic
1191879297 X:65828543-65828565 ATACAGGTCACCAGGGAAGTAGG - Intergenic
1192853024 X:74977670-74977692 ATACAGGTCTCCAGGGAAGTGGG + Intergenic
1194510106 X:94783346-94783368 ATACATGTCACCAGGGAAGTGGG - Intergenic
1194602534 X:95940425-95940447 ATACAGGTTGCCAGGGAAGCCGG - Intergenic
1195734224 X:107996439-107996461 ATACAGGTCACCAGGGAAGTGGG - Intergenic
1198604564 X:138322551-138322573 ATACAGGTCTCCAGGGAAGTGGG + Intergenic
1199014977 X:142804521-142804543 ATACAGGTCACCAGGGAAGTAGG + Intergenic