ID: 922345093

View in Genome Browser
Species Human (GRCh38)
Location 1:224689925-224689947
Sequence CCCAAACCTGCACTTTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922345093_922345103 26 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345103 1:224689974-224689996 GTTGGTGTGACTGCCGCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 67
922345093_922345099 -2 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345099 1:224689946-224689968 GGAGCAGGAAGCATCCTGGAAGG 0: 1
1: 0
2: 8
3: 169
4: 1525
922345093_922345104 27 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345104 1:224689975-224689997 TTGGTGTGACTGCCGCTTTTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
922345093_922345101 8 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345101 1:224689956-224689978 GCATCCTGGAAGGCAGAGGTTGG 0: 1
1: 0
2: 31
3: 1089
4: 17418
922345093_922345098 -6 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345098 1:224689942-224689964 TTTGGGAGCAGGAAGCATCCTGG 0: 1
1: 1
2: 6
3: 39
4: 284
922345093_922345100 4 Left 922345093 1:224689925-224689947 CCCCTACAAAGTGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 922345100 1:224689952-224689974 GGAAGCATCCTGGAAGGCAGAGG 0: 2
1: 0
2: 1
3: 38
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922345093 Original CRISPR CCCAAACCTGCACTTTGTAG GGG (reversed) Intronic
901208633 1:7511828-7511850 CCCCAAACTCCACTTTGTAGAGG + Intronic
901896991 1:12322311-12322333 CACAAAACTGCACCATGTAGCGG - Intronic
903310171 1:22449295-22449317 CCCAAACCTTGACTTTGAGGGGG - Intergenic
904921818 1:34013963-34013985 CCCAAACCTGCTCTTCCTATGGG + Intronic
904997162 1:34640021-34640043 CCAAAACCTGCACTGTCCAGAGG + Intergenic
906282736 1:44565469-44565491 CCCCAGCCTGCACTTCCTAGGGG - Intronic
908385955 1:63642082-63642104 CCCAACCCTGGACTGTGGAGTGG - Intronic
908848540 1:68350077-68350099 CCCAAACCTGCAGCATCTAGAGG - Intergenic
909344572 1:74571116-74571138 CCTAGACCTGCACGTTGTTGGGG + Exonic
913079284 1:115366716-115366738 CCCTCACCTGCCCTTTGTAGTGG - Intergenic
915164296 1:153940089-153940111 CTCAAACCTCCAGTTTGCAGAGG - Intronic
920390695 1:205598786-205598808 CCCTAACCAGAACTTTGCAGAGG - Intronic
922345093 1:224689925-224689947 CCCAAACCTGCACTTTGTAGGGG - Intronic
923102559 1:230827897-230827919 GGCAAACCTGCCCTTTGCAGGGG + Intergenic
1064097353 10:12433813-12433835 GCCAAACCCTCACTTTGTAAAGG + Intronic
1070873645 10:79780998-79781020 CCCAAACTTGCACTTTCTAATGG - Intergenic
1071640577 10:87303148-87303170 CCCAAACTTGCACTTTCTAATGG - Intergenic
1071654659 10:87434797-87434819 CCCAAACTTGCACTTTCTAATGG + Intergenic
1075101140 10:119507130-119507152 ACCACACCTGCCCTTTCTAGCGG + Intronic
1088401175 11:109423520-109423542 CCCAAAACTGCTCCCTGTAGCGG - Exonic
1091628998 12:2144590-2144612 CCCAAACCTAAACATTTTAGAGG - Intronic
1093794852 12:23299309-23299331 GACAAACCTGCACTCTTTAGTGG + Intergenic
1094780847 12:33790089-33790111 CCCAAACCTGCACACAGCAGGGG + Intergenic
1104389754 12:128381722-128381744 CTCAAAGCTGCTCTTTGTGGAGG - Intronic
1106590719 13:31096489-31096511 ACCTTACTTGCACTTTGTAGGGG - Intergenic
1112965910 13:105193300-105193322 CCCAAATCTGTACTTTGTGTAGG - Intergenic
1117175196 14:53138892-53138914 CCCAACCCTGCACTATGAAGGGG - Intronic
1125612520 15:40981299-40981321 TCAGAACCTGCACTGTGTAGAGG - Intronic
1125875900 15:43144246-43144268 CCAAAAACTGAACTTTGCAGGGG + Intronic
1127453460 15:59138079-59138101 CCTCAAACTGCAATTTGTAGAGG - Intronic
1131059875 15:89398098-89398120 CCCAAACCTGAACTGGGCAGTGG + Intergenic
1134776519 16:16858359-16858381 GCCAAAGAGGCACTTTGTAGAGG - Intergenic
1137002766 16:35245725-35245747 GTGAAACCTGCATTTTGTAGAGG - Intergenic
1141648962 16:85382436-85382458 CCCAATTCTGCACATTGCAGGGG - Intergenic
1141713517 16:85714034-85714056 CCCAAACCTGCAGCTGGTGGTGG + Intronic
1145877094 17:28327269-28327291 CCCAAACCTTCACCTTCTAAGGG + Exonic
1146949366 17:36894934-36894956 CCCCTAAGTGCACTTTGTAGAGG + Intergenic
1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG + Intronic
1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG + Intergenic
1153920359 18:9783378-9783400 CCCTTACCTGCACTGTGGAGGGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156353637 18:36322517-36322539 CCCAAACCTGCTCTTTCTTTTGG - Intronic
1163267625 19:16230788-16230810 ACCAAACCTGCACTGTGTGAAGG + Intronic
1164296038 19:23910947-23910969 CCAAAAGCTGCACCTTGTGGAGG - Intergenic
1166774538 19:45304363-45304385 CTCAGAGCTGCACTTAGTAGGGG + Intronic
926352197 2:12006162-12006184 CACAAACCTGCAGTTTGTGCAGG - Intergenic
929818517 2:45255503-45255525 TCCAAACTTGCACTTCGTAAAGG + Intergenic
934146746 2:89102162-89102184 CCCCAACCTCCACGTTGTTGAGG - Intergenic
934222518 2:90098430-90098452 CCCCAACCTCCACGTTGTTGAGG + Intergenic
935576197 2:104713499-104713521 ACCAAACCTGTAATTAGTAGAGG - Intergenic
935889689 2:107662747-107662769 TCCAAAGCTGTCCTTTGTAGGGG - Intergenic
936460828 2:112712818-112712840 CAAAAACCTGGCCTTTGTAGGGG - Intergenic
938388528 2:130885493-130885515 CCCACACATGCTTTTTGTAGTGG + Intronic
946197940 2:218049162-218049184 CCCAAACCTGCCATTTGGAATGG - Intronic
1171483731 20:25471949-25471971 CCAATACCTGCAGTTTCTAGAGG - Intronic
1172707432 20:36892261-36892283 CCCAACCTGGCACCTTGTAGGGG + Exonic
1173075102 20:39810844-39810866 GCCAGACCTGCACTGTGAAGAGG + Intergenic
1174284581 20:49463610-49463632 GACCAAACTGCACTTTGTAGAGG - Intronic
1174303321 20:49597690-49597712 GACCAAACTGCACTTTGTAGAGG - Intergenic
1178082755 21:29081731-29081753 CCCAAACTTGCAATCTGTGGTGG - Intronic
1178092893 21:29183242-29183264 CACAAACTTGCACTTTGGTGAGG + Intergenic
1181483290 22:23214744-23214766 TCCAAACCTGCATTTGGAAGGGG + Intronic
1181649379 22:24250314-24250336 CCCAAACCTGCCCTTTCTGCAGG - Intergenic
1181860943 22:25817863-25817885 CCCAAAGGTGCACCTTGTAGTGG - Intronic
1182255083 22:29032065-29032087 GCCAAACCTGCACTTTCCTGGGG + Intronic
949446631 3:4141843-4141865 CCCAAACCTTCATTTTGTGCTGG - Intronic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950704495 3:14771547-14771569 CCCAAATTTCCCCTTTGTAGAGG + Intronic
955346120 3:58163239-58163261 CCCCAACGCGCACTTTGAAGGGG - Exonic
957857496 3:85896552-85896574 ACCAAAGCTGGACTCTGTAGTGG + Intronic
959133809 3:102391726-102391748 CGCAAATCTGCAATTTGTACAGG - Intronic
961666628 3:128496963-128496985 CGCACACCTGCACTTTTTTGTGG - Intergenic
966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG + Exonic
966578110 3:181526465-181526487 CACAAACCTTCACTTTCTTGAGG + Intergenic
967370741 3:188742962-188742984 ACCTAACCTGGACCTTGTAGAGG - Intronic
967510705 3:190308293-190308315 CCAAAACCTGCACCTTCCAGCGG - Exonic
968541218 4:1169358-1169380 CCCAAGCCTGCACTGGGCAGGGG + Intronic
969551502 4:7871204-7871226 CCCAAAGCTGCTCTCTCTAGAGG + Intronic
970137351 4:12940182-12940204 ACCAAACATGCACTATGTATAGG - Intergenic
971485398 4:27155071-27155093 ACTAAATCTGCACTTTTTAGAGG + Intergenic
971870926 4:32237490-32237512 CCCAAAACTGGACTTAGTAAGGG - Intergenic
972080754 4:35145617-35145639 ACCAGAGCTGCACTTTGAAGGGG - Intergenic
973433940 4:50199094-50199116 TTCAAACCTGCACTATGAAGAGG - Intergenic
973442384 4:50338193-50338215 TTCAAACCTGCACTATGAAGAGG - Intergenic
973474972 4:50876119-50876141 TTCAAACCTGCACTATGAAGAGG - Intergenic
973495674 4:51218448-51218470 TTCAAACCTGCACTATGAAGAGG - Intergenic
973514880 4:51534449-51534471 TTCAAACCTGCACTATGAAGAGG - Intergenic
974489971 4:62551989-62552011 CCCAAACCTGCATGATTTAGCGG + Intergenic
975902119 4:79165359-79165381 CCCAAGCCTGCAGTTTAGAGTGG - Intergenic
976112845 4:81694885-81694907 CACAATTCTGCACCTTGTAGAGG + Intronic
979572984 4:122252182-122252204 CCTAAACCAGCACATCGTAGAGG - Intronic
980221593 4:129924237-129924259 CCCATACTTACATTTTGTAGGGG - Intergenic
980603768 4:135061981-135062003 CCCAATCATGCACTGTGTTGTGG + Intergenic
980708369 4:136529934-136529956 TCCAAAACTGCTCTTTTTAGTGG + Intergenic
984552864 4:181181650-181181672 CCCAAACCTGGACTCTGTAAAGG + Intergenic
984770227 4:183430828-183430850 CCCAGGCCTGCACTTTGGAGAGG + Intergenic
985013331 4:185606689-185606711 CCCACACCTGCACATTGAAGAGG - Intronic
987048121 5:14126417-14126439 ACCAAACCAAGACTTTGTAGCGG - Intergenic
993496860 5:88617487-88617509 AACAAACCTGCACTTTGTGCAGG - Intergenic
993645718 5:90458119-90458141 CTCAAAACTGCACTTTATACAGG + Intergenic
995289346 5:110432416-110432438 CCCAAACATGCAGTTTCTAAGGG + Intronic
1002272890 5:178084318-178084340 CCCATGCCTCCACCTTGTAGCGG - Intergenic
1004082075 6:12404594-12404616 CCCAAACCTGCTCTCAGTAAAGG + Intergenic
1004756044 6:18611495-18611517 CCCAAACCTGCTTTTTGGAAAGG + Intergenic
1005974564 6:30788213-30788235 CCCAAGGCTGCCCTTTGTACGGG - Intergenic
1009717589 6:67419405-67419427 CCCACACGTGCATTTTGGAGTGG + Intergenic
1009807271 6:68616988-68617010 CCCTAACCTGCACATTGTTTAGG + Intergenic
1012047603 6:94298429-94298451 CCCAAACCTTCACCTTCTAAGGG - Intergenic
1013776564 6:113685023-113685045 CCCAAACCTCAACCTTGTATAGG + Intergenic
1014682094 6:124443572-124443594 CCCAAACCTGCAAATTATAGGGG + Intronic
1017791969 6:157807886-157807908 TCCAAACCTGCATTATGCAGAGG + Intronic
1017959103 6:159206525-159206547 CCCATACCTGTGCTTGGTAGAGG + Intronic
1019919557 7:4154787-4154809 CCCAAACCTCTGCTTTGGAGTGG - Intronic
1021690119 7:23223141-23223163 CCCAAACCTTCTCTTTGCAGAGG - Intergenic
1028870505 7:95766396-95766418 CACTAACCTTCAATTTGTAGGGG - Intergenic
1029730866 7:102437062-102437084 CCCAAATCTCCACTAAGTAGGGG - Intronic
1033655910 7:143374254-143374276 CCCAGACCTGTACTTTTCAGTGG + Intergenic
1048972485 8:139653007-139653029 CCCAATGATGCACCTTGTAGGGG + Intronic
1050744825 9:8863162-8863184 CCCTCACCTGCAGTGTGTAGAGG + Intronic
1051285410 9:15491417-15491439 CACAAACATGCACTGAGTAGTGG - Intronic
1052779324 9:32764702-32764724 TCCAAAGCTGGACTTTTTAGAGG - Intergenic
1059457064 9:114406421-114406443 CACAAACCAGCACTTTGTCATGG - Exonic
1059669213 9:116477298-116477320 CCCAACTGTGCACTTTGGAGAGG + Intronic
1059692906 9:116702989-116703011 CCCAACACTGCACTTTTAAGAGG - Intronic
1060855833 9:126914713-126914735 CCCCAACCAGCTCGTTGTAGGGG - Intergenic
1185578342 X:1191467-1191489 CCCAAACAAGAGCTTTGTAGGGG - Intronic
1187202439 X:17148136-17148158 CCAAAACCTCCACTTTACAGAGG - Exonic
1190469553 X:50764513-50764535 CCCAACCCAGCTCTTTGTCGTGG - Intronic
1193597162 X:83461050-83461072 CCCAATCCTGCACATTGCATGGG - Intergenic
1195556220 X:106227979-106228001 CCCAAACCTGCATTTTTGAAGGG + Intergenic
1197419892 X:126225839-126225861 CCCAATTCTGCAGTTTGTACAGG - Intergenic
1197622126 X:128762718-128762740 CTCAATCCTTCACTTTCTAGTGG + Intergenic
1198551379 X:137749076-137749098 CGCCAACCAGCTCTTTGTAGAGG - Intergenic
1201241410 Y:11960511-11960533 CACAGAACTGCACTTTGTACAGG + Intergenic