ID: 922349889

View in Genome Browser
Species Human (GRCh38)
Location 1:224726666-224726688
Sequence GTTTGTGATCAAAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922349889_922349892 -5 Left 922349889 1:224726666-224726688 CCAACTTCCCTTTGATCACAAAC No data
Right 922349892 1:224726684-224726706 CAAACCTTCCATGATCCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 136
922349889_922349894 -1 Left 922349889 1:224726666-224726688 CCAACTTCCCTTTGATCACAAAC No data
Right 922349894 1:224726688-224726710 CCTTCCATGATCCCCCTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922349889 Original CRISPR GTTTGTGATCAAAGGGAAGT TGG (reversed) Intronic
No off target data available for this crispr