ID: 922350627

View in Genome Browser
Species Human (GRCh38)
Location 1:224732243-224732265
Sequence CCTCACCTGCACCCAATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922350627_922350634 7 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350634 1:224732273-224732295 AGCCTCTAGGCTGCGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 135
922350627_922350636 10 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350636 1:224732276-224732298 CTCTAGGCTGCGTGGCCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 118
922350627_922350637 17 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350637 1:224732283-224732305 CTGCGTGGCCGGGAGGTCGATGG 0: 1
1: 0
2: 0
3: 7
4: 89
922350627_922350633 6 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350633 1:224732272-224732294 AAGCCTCTAGGCTGCGTGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 94
922350627_922350631 -6 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350631 1:224732260-224732282 GTGAGGGAGAGAAAGCCTCTAGG 0: 1
1: 1
2: 0
3: 38
4: 382
922350627_922350632 2 Left 922350627 1:224732243-224732265 CCCATAATTGGGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 922350632 1:224732268-224732290 GAGAAAGCCTCTAGGCTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922350627 Original CRISPR CCTCACCTGCACCCAATTAT GGG (reversed) Intronic
900768616 1:4522269-4522291 CCTCTCCTTCACCCAATCCTTGG - Intergenic
905965570 1:42092614-42092636 ACTCACCTCCACCCCATTAAGGG + Intergenic
907239879 1:53075487-53075509 CCTCACTTGCCCCCCATTCTTGG + Intronic
908639556 1:66206650-66206672 CCTTACCTGCAACTTATTATTGG - Intronic
908717463 1:67085775-67085797 CCACACCTGCATCCAATCCTGGG + Intergenic
911399239 1:97353950-97353972 CCTCATCTGGACCCAAATCTCGG - Intronic
911743134 1:101409925-101409947 TCTAACCTACCCCCAATTATTGG + Intergenic
914903760 1:151727605-151727627 ACTCACCTGCAGCAAATTCTAGG - Exonic
914956546 1:152167644-152167666 CATCAACTGCCCCCACTTATGGG - Intergenic
916611157 1:166393061-166393083 CCTCACCTGCACCTATGTCTTGG - Intergenic
917575564 1:176317768-176317790 CCCCAACTGCCCCCAAGTATTGG - Intergenic
922350627 1:224732243-224732265 CCTCACCTGCACCCAATTATGGG - Intronic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1063823210 10:9861802-9861824 CCTCAGCTGGGCCAAATTATTGG + Intergenic
1063851057 10:10191056-10191078 CCTCACCTGGACCCAATTCTTGG + Intergenic
1068444861 10:57108024-57108046 TCTCACCCGCACTTAATTATGGG - Intergenic
1071526485 10:86362640-86362662 CCTCTGCTGCACCCAAGAATAGG + Intronic
1073561263 10:104498823-104498845 CCTCACCCCCACCCAACTACTGG - Intergenic
1082750741 11:57013221-57013243 CCTCAGCTGTTCCCAATTTTAGG + Intergenic
1086083794 11:82934207-82934229 CCTCAGCTGCACCCTATTCTTGG + Exonic
1089394402 11:118126472-118126494 CCTCACCTGCAAGCCATTACAGG + Intergenic
1091797453 12:3305421-3305443 CCTCCCCTGCTCCCTATTCTGGG + Intergenic
1092452629 12:8617246-8617268 CCACACCTGGCCCCTATTATTGG - Intergenic
1096547530 12:52350929-52350951 CTTCACCTGCCCTCAATTCTTGG - Intergenic
1099787680 12:87287273-87287295 ACTCCCCTGCCCCCAATTTTAGG + Intergenic
1106887913 13:34209978-34210000 TCTCACTTACACCCAATTATAGG - Intergenic
1115468995 14:33748416-33748438 CCCCACTTGTACCCAATTCTAGG + Intronic
1130339319 15:82985959-82985981 CGTCACCTGCTCCCAATCAAAGG + Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1133618212 16:7499836-7499858 CCTAAGTTGCACACAATTATTGG + Intronic
1135227181 16:20671112-20671134 CCTCACCTCTCCCCTATTATGGG - Intronic
1139128707 16:64114050-64114072 CCTCACTTCTACCCAGTTATTGG + Intergenic
1142506996 17:370811-370833 ACTCATCTGGACCCAATTGTGGG - Intronic
1146973061 17:37088114-37088136 CCTCACCTGCATCTCATCATGGG + Intronic
1161816575 19:6502866-6502888 CAGCATCTGCACCCAATCATGGG - Intergenic
1162905961 19:13824259-13824281 CCTCATCTAAACCTAATTATTGG + Intronic
1163618937 19:18346366-18346388 CGTCACCTCCACCCAAAGATGGG + Intronic
928231925 2:29505672-29505694 GCTGCCCTGCACCCATTTATTGG - Intronic
929690540 2:44068907-44068929 CCTCCCCAACACCAAATTATTGG - Intergenic
931819054 2:65933402-65933424 ACACACCTGCCCCCAACTATTGG + Intergenic
932698625 2:73977899-73977921 CCTCACCTGCAGCCAAAAACTGG + Intergenic
938631848 2:133176116-133176138 CCACACCTGCACCCTTTTGTTGG - Intronic
943302157 2:186216768-186216790 CCTAACCTGAAGCAAATTATCGG + Intergenic
945898702 2:215514400-215514422 CCTCACCTGGACCCCCATATTGG + Intergenic
947451375 2:230212084-230212106 CCTCACCCCCACCTGATTATGGG - Intronic
947927740 2:233936468-233936490 CCTCATCTACCCCAAATTATTGG + Intronic
1171842658 20:30233994-30234016 CCTCAGCTGCATCCTATAATAGG + Intergenic
1174138040 20:48393935-48393957 CCTCACCTCCTCCCACTTCTCGG - Intergenic
1175604975 20:60305168-60305190 CCTCACCTTCACCCCATTCACGG - Intergenic
1180932247 22:19600192-19600214 CCTCACCTCCACCCAAGTCGAGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954613300 3:51957396-51957418 CCTCAGCTGCACCCATTTTCTGG + Exonic
955540480 3:59971007-59971029 GCTCAGCTGCACACAATTATGGG + Intronic
959318636 3:104842457-104842479 CCTCACCTTCACCCACTTTTTGG - Intergenic
959559362 3:107761834-107761856 CCTCCACTGCTCCCAATTATTGG + Intronic
962441476 3:135422414-135422436 CCTCCCCTGCACCCCATAACAGG + Intergenic
962856784 3:139353775-139353797 CAACACCAGCCCCCAATTATGGG - Intronic
964307082 3:155353466-155353488 CGTGTCCTGCACCCAATTAGGGG - Intergenic
968956536 4:3722405-3722427 CTTCACCTGCCCCCACTTAACGG - Intergenic
969376965 4:6769301-6769323 CCGCAGCTGCACCCAGGTATGGG - Intergenic
975451689 4:74535133-74535155 GTTCAGCTGCAACCAATTATAGG - Intergenic
980844369 4:138306392-138306414 CCTCATCTGCTAGCAATTATTGG - Intergenic
983057016 4:163109838-163109860 CCTCACCTGATCCTATTTATAGG - Intergenic
992544819 5:77802803-77802825 CCTCCCCATCACCCAATTCTTGG - Intronic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
999315476 5:150580742-150580764 CCTCTCCTCCACCCAATGAGGGG - Intergenic
1005450971 6:25972083-25972105 CCTCACCTGCAGCAATTTCTGGG - Exonic
1005731216 6:28698747-28698769 CCTGGCCTGGACCCAATTAATGG + Intergenic
1007091526 6:39187688-39187710 CCACACCTCCACCCAATCTTGGG + Intergenic
1008471517 6:51890310-51890332 CTTCACTTGCACCCTATTATTGG - Intronic
1014041171 6:116827485-116827507 CCTTACCTGTACCCTATTATAGG - Intronic
1014491221 6:122064422-122064444 ACTCTCCTGCACCCAGTTAGGGG - Intergenic
1014697834 6:124645934-124645956 CCTCACCCTCACCCAGTTCTTGG + Intronic
1016563034 6:145418380-145418402 CCTCACCTGCACCCAGCAGTTGG - Intergenic
1027364643 7:77444818-77444840 GCTCACCTCCATCCAAATATTGG - Intergenic
1028134478 7:87211155-87211177 CCTCAACTGCATCTCATTATTGG + Intronic
1033354292 7:140586879-140586901 CCTCACCAGCACACACATATGGG + Intronic
1034441944 7:151090149-151090171 CCTCACCTGCACACAACGACTGG - Intronic
1035052143 7:156005130-156005152 CCTCACCGGCACCCACTTGCAGG + Intergenic
1038270055 8:26067721-26067743 CCTCCCCTGCACCCCATGACTGG - Intergenic
1045473944 8:102537451-102537473 GCTCAGCTGCACCCAATTAAAGG - Intronic
1046112422 8:109741438-109741460 CCCCACCTGCTGCCAATTAGTGG + Intergenic
1050205094 9:3187729-3187751 CCTCACCTGAAGGCAATTATTGG + Intergenic
1050227741 9:3479880-3479902 CCTCAGATTCACCCAAGTATAGG + Intronic
1050263110 9:3861778-3861800 CCTCCCCTGCACCCACTAACAGG - Intronic
1054165328 9:61720669-61720691 CCTCAGCTGCATCCTATAATCGG - Intergenic
1056480925 9:87005173-87005195 TGTGACCTGCACCCAACTATAGG + Intergenic
1059336604 9:113572945-113572967 CCTCTCCTGCATCCAATTCCGGG - Intronic
1059625936 9:116066141-116066163 CCTAAGCTGCATCCAGTTATTGG + Intergenic
1061674325 9:132207269-132207291 CCTGACCTCCACCCAGTTAGTGG - Intronic
1062181609 9:135194044-135194066 CCCCACCTGCACCCTCTTCTTGG - Intergenic
1186504601 X:10081178-10081200 CCTCACCAGGAACCAAATATTGG - Intronic
1188057198 X:25555013-25555035 CTTCACCTGCATCCAATTTAAGG - Intergenic
1190154136 X:47973902-47973924 CCTCACCCCCACCCCACTATAGG + Intronic
1196504507 X:116425376-116425398 CCTCACATGCACCCATTATTTGG + Intergenic
1199623147 X:149716565-149716587 CTTTTCCTGCACCCAATTTTGGG - Exonic
1200700188 Y:6395516-6395538 CCTCACCTGCACCCATTTTAAGG - Intergenic
1201033923 Y:9769182-9769204 CCTCACCTGCACCCATTTTAAGG + Intergenic