ID: 922350733

View in Genome Browser
Species Human (GRCh38)
Location 1:224732946-224732968
Sequence AAGAAAAAAAAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13013
Summary {0: 1, 1: 4, 2: 134, 3: 1414, 4: 11460}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922350730_922350733 7 Left 922350730 1:224732916-224732938 CCTGGCAATTAGTAAGTTCTCAG 0: 1
1: 0
2: 20
3: 215
4: 1252
Right 922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG 0: 1
1: 4
2: 134
3: 1414
4: 11460
922350728_922350733 29 Left 922350728 1:224732894-224732916 CCTGACAGGATCTAGTCTAGTTC 0: 1
1: 1
2: 0
3: 3
4: 59
Right 922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG 0: 1
1: 4
2: 134
3: 1414
4: 11460
922350727_922350733 30 Left 922350727 1:224732893-224732915 CCCTGACAGGATCTAGTCTAGTT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG 0: 1
1: 4
2: 134
3: 1414
4: 11460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922350733 Original CRISPR AAGAAAAAAAAGAATGAGGA GGG Intronic
Too many off-targets to display for this crispr