ID: 922353009

View in Genome Browser
Species Human (GRCh38)
Location 1:224750286-224750308
Sequence CATGGGAGACAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922353009_922353016 25 Left 922353009 1:224750286-224750308 CCCTCTTCCTTCTGTCTCCCATG No data
Right 922353016 1:224750334-224750356 TGCTCCCTCCCTTGACACCAAGG No data
922353009_922353012 -7 Left 922353009 1:224750286-224750308 CCCTCTTCCTTCTGTCTCCCATG No data
Right 922353012 1:224750302-224750324 TCCCATGTGAGCAAACCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922353009 Original CRISPR CATGGGAGACAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr