ID: 922353204

View in Genome Browser
Species Human (GRCh38)
Location 1:224752331-224752353
Sequence GGTCCCAGTGGGCATATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922353204_922353210 -7 Left 922353204 1:224752331-224752353 CCATCCATATGCCCACTGGGACC No data
Right 922353210 1:224752347-224752369 TGGGACCTCAGGGCCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922353204 Original CRISPR GGTCCCAGTGGGCATATGGA TGG (reversed) Intergenic
No off target data available for this crispr