ID: 922354350

View in Genome Browser
Species Human (GRCh38)
Location 1:224761823-224761845
Sequence TCTGATTCAGAATATGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922354350_922354354 -4 Left 922354350 1:224761823-224761845 CCCTGTCCATATTCTGAATCAGA No data
Right 922354354 1:224761842-224761864 CAGAAATAAGGCAGAGAGTAAGG No data
922354350_922354355 6 Left 922354350 1:224761823-224761845 CCCTGTCCATATTCTGAATCAGA No data
Right 922354355 1:224761852-224761874 GCAGAGAGTAAGGAAGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922354350 Original CRISPR TCTGATTCAGAATATGGACA GGG (reversed) Intergenic
No off target data available for this crispr