ID: 922356721

View in Genome Browser
Species Human (GRCh38)
Location 1:224783306-224783328
Sequence GAAGGAAAACAGAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922356713_922356721 8 Left 922356713 1:224783275-224783297 CCCATCTAAAATTATGGGTTGAT No data
Right 922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG No data
922356710_922356721 27 Left 922356710 1:224783256-224783278 CCTCAAGTCTATCTCTTCTCCCA No data
Right 922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG No data
922356714_922356721 7 Left 922356714 1:224783276-224783298 CCATCTAAAATTATGGGTTGATT No data
Right 922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922356721 Original CRISPR GAAGGAAAACAGAAGGGGCA AGG Intergenic
No off target data available for this crispr