ID: 922358388

View in Genome Browser
Species Human (GRCh38)
Location 1:224798117-224798139
Sequence TGCCCCACCAAAACTATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922358388_922358398 22 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358398 1:224798162-224798184 TGGAGGTGGACTAGTTCCAGGGG No data
922358388_922358395 8 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358395 1:224798148-224798170 GGTAAGCAGATAGTTGGAGGTGG No data
922358388_922358396 20 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358396 1:224798160-224798182 GTTGGAGGTGGACTAGTTCCAGG No data
922358388_922358394 5 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG No data
922358388_922358392 2 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358392 1:224798142-224798164 TTTCCTGGTAAGCAGATAGTTGG No data
922358388_922358397 21 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358397 1:224798161-224798183 TTGGAGGTGGACTAGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922358388 Original CRISPR TGCCCCACCAAAACTATATG GGG (reversed) Intergenic
No off target data available for this crispr