ID: 922358394

View in Genome Browser
Species Human (GRCh38)
Location 1:224798145-224798167
Sequence CCTGGTAAGCAGATAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922358390_922358394 3 Left 922358390 1:224798119-224798141 CCATATAGTTTTGGTGGGGCAGA No data
Right 922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG No data
922358388_922358394 5 Left 922358388 1:224798117-224798139 CCCCATATAGTTTTGGTGGGGCA No data
Right 922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG No data
922358389_922358394 4 Left 922358389 1:224798118-224798140 CCCATATAGTTTTGGTGGGGCAG No data
Right 922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922358394 Original CRISPR CCTGGTAAGCAGATAGTTGG AGG Intergenic
No off target data available for this crispr