ID: 922364490

View in Genome Browser
Species Human (GRCh38)
Location 1:224851325-224851347
Sequence CATTCCAAGCCTGCACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922364490_922364501 25 Left 922364490 1:224851325-224851347 CCATCCAGTGCAGGCTTGGAATG No data
Right 922364501 1:224851373-224851395 CAGACCCACCTGCTCCAGGGTGG No data
922364490_922364500 22 Left 922364490 1:224851325-224851347 CCATCCAGTGCAGGCTTGGAATG No data
Right 922364500 1:224851370-224851392 AGTCAGACCCACCTGCTCCAGGG No data
922364490_922364499 21 Left 922364490 1:224851325-224851347 CCATCCAGTGCAGGCTTGGAATG No data
Right 922364499 1:224851369-224851391 CAGTCAGACCCACCTGCTCCAGG No data
922364490_922364496 -8 Left 922364490 1:224851325-224851347 CCATCCAGTGCAGGCTTGGAATG No data
Right 922364496 1:224851340-224851362 TTGGAATGGGGGTCGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922364490 Original CRISPR CATTCCAAGCCTGCACTGGA TGG (reversed) Intergenic
No off target data available for this crispr