ID: 922364650

View in Genome Browser
Species Human (GRCh38)
Location 1:224852276-224852298
Sequence AGCCCAGAAGCCCATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922364647_922364650 -7 Left 922364647 1:224852260-224852282 CCAGCTCATCCCTGGGAGCCCAG No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data
922364644_922364650 -4 Left 922364644 1:224852257-224852279 CCCCCAGCTCATCCCTGGGAGCC No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data
922364645_922364650 -5 Left 922364645 1:224852258-224852280 CCCCAGCTCATCCCTGGGAGCCC No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data
922364641_922364650 0 Left 922364641 1:224852253-224852275 CCCACCCCCAGCTCATCCCTGGG No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data
922364643_922364650 -1 Left 922364643 1:224852254-224852276 CCACCCCCAGCTCATCCCTGGGA No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data
922364646_922364650 -6 Left 922364646 1:224852259-224852281 CCCAGCTCATCCCTGGGAGCCCA No data
Right 922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922364650 Original CRISPR AGCCCAGAAGCCCATGAAGA AGG Intergenic
No off target data available for this crispr