ID: 922365594

View in Genome Browser
Species Human (GRCh38)
Location 1:224860530-224860552
Sequence CTTTGTTAGTATAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922365594_922365596 6 Left 922365594 1:224860530-224860552 CCATCACACTTATACTAACAAAG No data
Right 922365596 1:224860559-224860581 TAAATTAGTAAAGTCCCTGTTGG No data
922365594_922365599 30 Left 922365594 1:224860530-224860552 CCATCACACTTATACTAACAAAG No data
Right 922365599 1:224860583-224860605 TAGCCTGCTGACTGCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922365594 Original CRISPR CTTTGTTAGTATAAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr