ID: 922367594

View in Genome Browser
Species Human (GRCh38)
Location 1:224880633-224880655
Sequence CTGTTTGCACACTGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922367586_922367594 11 Left 922367586 1:224880599-224880621 CCAAGTTAAAAGGGCTCCCCGGA No data
Right 922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG No data
922367589_922367594 -7 Left 922367589 1:224880617-224880639 CCGGAGAATCTCCGACCTGTTTG No data
Right 922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG No data
922367588_922367594 -6 Left 922367588 1:224880616-224880638 CCCGGAGAATCTCCGACCTGTTT No data
Right 922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG No data
922367587_922367594 -5 Left 922367587 1:224880615-224880637 CCCCGGAGAATCTCCGACCTGTT No data
Right 922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922367594 Original CRISPR CTGTTTGCACACTGGGAAGA TGG Intergenic
No off target data available for this crispr