ID: 922368933

View in Genome Browser
Species Human (GRCh38)
Location 1:224890588-224890610
Sequence CCCTATAGCTTCTCAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922368933_922368939 21 Left 922368933 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG No data
Right 922368939 1:224890632-224890654 TATGGATGTACCTTCTTGTTGGG No data
922368933_922368936 3 Left 922368933 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368933_922368938 20 Left 922368933 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG No data
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922368933 Original CRISPR CCCTATAGCTTCTCAAGGAC AGG (reversed) Intergenic