ID: 922368935 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:224890593-224890615 |
Sequence | CTATACCCTATAGCTTCTCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922368935_922368938 | 15 | Left | 922368935 | 1:224890593-224890615 | CCTTGAGAAGCTATAGGGTATAG | No data | ||
Right | 922368938 | 1:224890631-224890653 | ATATGGATGTACCTTCTTGTTGG | No data | ||||
922368935_922368936 | -2 | Left | 922368935 | 1:224890593-224890615 | CCTTGAGAAGCTATAGGGTATAG | No data | ||
Right | 922368936 | 1:224890614-224890636 | AGTCCATTTGAACTTTTATATGG | No data | ||||
922368935_922368939 | 16 | Left | 922368935 | 1:224890593-224890615 | CCTTGAGAAGCTATAGGGTATAG | No data | ||
Right | 922368939 | 1:224890632-224890654 | TATGGATGTACCTTCTTGTTGGG | 0: 2 1: 0 2: 5 3: 28 4: 186 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922368935 | Original CRISPR | CTATACCCTATAGCTTCTCA AGG (reversed) | Intergenic | ||