ID: 922368935

View in Genome Browser
Species Human (GRCh38)
Location 1:224890593-224890615
Sequence CTATACCCTATAGCTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922368935_922368936 -2 Left 922368935 1:224890593-224890615 CCTTGAGAAGCTATAGGGTATAG No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368935_922368938 15 Left 922368935 1:224890593-224890615 CCTTGAGAAGCTATAGGGTATAG No data
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data
922368935_922368939 16 Left 922368935 1:224890593-224890615 CCTTGAGAAGCTATAGGGTATAG No data
Right 922368939 1:224890632-224890654 TATGGATGTACCTTCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922368935 Original CRISPR CTATACCCTATAGCTTCTCA AGG (reversed) Intergenic