ID: 922368936

View in Genome Browser
Species Human (GRCh38)
Location 1:224890614-224890636
Sequence AGTCCATTTGAACTTTTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922368935_922368936 -2 Left 922368935 1:224890593-224890615 CCTTGAGAAGCTATAGGGTATAG No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368931_922368936 17 Left 922368931 1:224890574-224890596 CCTTAGAATTAGAACCTGTCCTT No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368929_922368936 21 Left 922368929 1:224890570-224890592 CCCTCCTTAGAATTAGAACCTGT No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368933_922368936 3 Left 922368933 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368930_922368936 20 Left 922368930 1:224890571-224890593 CCTCCTTAGAATTAGAACCTGTC No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data
922368928_922368936 28 Left 922368928 1:224890563-224890585 CCGTTTGCCCTCCTTAGAATTAG No data
Right 922368936 1:224890614-224890636 AGTCCATTTGAACTTTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922368936 Original CRISPR AGTCCATTTGAACTTTTATA TGG Intergenic