ID: 922368937

View in Genome Browser
Species Human (GRCh38)
Location 1:224890617-224890639
Sequence CATCCATATAAAAGTTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922368937_922368938 -9 Left 922368937 1:224890617-224890639 CCATTTGAACTTTTATATGGATG No data
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data
922368937_922368945 25 Left 922368937 1:224890617-224890639 CCATTTGAACTTTTATATGGATG No data
Right 922368945 1:224890665-224890687 GTGCCAGACACCAGCCCTCTAGG No data
922368937_922368939 -8 Left 922368937 1:224890617-224890639 CCATTTGAACTTTTATATGGATG No data
Right 922368939 1:224890632-224890654 TATGGATGTACCTTCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922368937 Original CRISPR CATCCATATAAAAGTTCAAA TGG (reversed) Intergenic