ID: 922368938

View in Genome Browser
Species Human (GRCh38)
Location 1:224890631-224890653
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922368933_922368938 20 Left 922368933 1:224890588-224890610 CCTGTCCTTGAGAAGCTATAGGG No data
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data
922368935_922368938 15 Left 922368935 1:224890593-224890615 CCTTGAGAAGCTATAGGGTATAG No data
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data
922368937_922368938 -9 Left 922368937 1:224890617-224890639 CCATTTGAACTTTTATATGGATG 0: 22
1: 32
2: 19
3: 43
4: 355
Right 922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr