ID: 922369836

View in Genome Browser
Species Human (GRCh38)
Location 1:224898273-224898295
Sequence CTGAATAGACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 22, 2: 53, 3: 110, 4: 506}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922369836 Original CRISPR CTGAATAGACAAATGGACAA TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900961098 1:5920654-5920676 CAGAAAAGAAAAATGGGCAAAGG - Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905459106 1:38110244-38110266 CTCATTAGAAAAATGGGCAAAGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906664618 1:47611238-47611260 CTCAATAGAAAAATTGGCAAAGG + Intergenic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909404969 1:75278064-75278086 CTGAATAGACACATGGGTAGTGG - Intronic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
910270372 1:85387629-85387651 CTCAAAAGACAAAAAGACAAGGG - Intronic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
911548035 1:99244297-99244319 CTGATTAGACAACTTGAAAAGGG - Intergenic
911846236 1:102754767-102754789 CCAAATAGAAAAATGCACAATGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912902250 1:113664129-113664151 GTAAAAAGACAAATGGAGAATGG - Intronic
913050398 1:115112578-115112600 CTGAATAGGCAAATGCCCAGAGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914325340 1:146609442-146609464 CACAATAGAAAAATGGGCAAAGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916402725 1:164466567-164466589 CTGAATAGGCAAATAAACAGTGG - Intergenic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919541778 1:198855926-198855948 CTAAAGAGACAAATGAACAGTGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922722780 1:227907015-227907037 GTGAAAAGACAAATGGGCATGGG - Intergenic
923386307 1:233468104-233468126 GGGATTAGACAAATGGACATAGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924209908 1:241754067-241754089 CAGATTAGAAAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1063147333 10:3308060-3308082 CTGAAAAGACAATAGGCCAAGGG + Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067690844 10:48501073-48501095 GTGAAAAGACAAATGGCAAAAGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1070873861 10:79783198-79783220 ATCAACAGATAAATGGACAAAGG - Intergenic
1071128410 10:82363170-82363192 CTCAATAGGGAAATTGACAAAGG + Intronic
1071155342 10:82681992-82682014 CTGAATAGAACACTGGGCAAGGG + Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071421918 10:85509034-85509056 GTGAATAGACAAATGAGCATGGG + Intergenic
1071640794 10:87305337-87305359 ATCAACAGATAAATGGACAAAGG - Intergenic
1071654442 10:87432599-87432621 ATCAACAGATAAATGGACAAAGG + Intergenic
1072202428 10:93172654-93172676 CTGAACAGACTAATGCACTAGGG + Intergenic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1073898765 10:108194388-108194410 GTGAATAGACAAGAGGACCAGGG - Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075542454 10:123326428-123326450 CTGAATAGACTCAAGGACACTGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078656152 11:13242003-13242025 CTCAATAGATCAATGGCCAAAGG - Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1085021151 11:73209309-73209331 CTTAATAGAAAAATGGCTAAAGG + Intergenic
1085453414 11:76652209-76652231 CTCAGTAGAAAAATGGGCAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087425289 11:97977946-97977968 CTGAATTGACACCTGGATAAAGG - Intergenic
1087578613 11:100023885-100023907 CTGAATAGATAAATGAACTGTGG - Intronic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091700383 12:2655063-2655085 CTGAAGAGACCATTGAACAATGG + Intronic
1092633206 12:10408328-10408350 CTGAATAGAAGAATGCAGAAAGG - Exonic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094351322 12:29528673-29528695 CTCAAATGACAAATGGACATTGG + Intronic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094756817 12:33480571-33480593 CTGAATAGCCACATGCAAAAGGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1097715626 12:62962890-62962912 ATAAAAAGACAAAAGGACAAAGG + Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098678710 12:73322674-73322696 CAGAATAGATAAATGAAGAAAGG + Intergenic
1100400864 12:94228023-94228045 CAGATTAGAGAAATGGAAAATGG - Intronic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101383273 12:104232979-104233001 CTAAATAGGTAAATGCACAATGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107015917 13:35707588-35707610 CTGAATTGTCATAAGGACAAAGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108556046 13:51593711-51593733 TTCAATGGAGAAATGGACAAAGG - Intronic
1108584013 13:51852312-51852334 CCCAATAGATAAATGGCCAAAGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111157430 13:84346799-84346821 TTGAATGGATAAATGTACAATGG - Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112977416 13:105337909-105337931 GTGAAAAGACAAAAGGAAAAGGG + Intergenic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117469952 14:56033518-56033540 CAGAATAGAAAAATTGATAATGG + Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119089527 14:71768052-71768074 TCCAATAGAAAAATGGACAAAGG + Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120062131 14:79996572-79996594 CTGAGTAGACAAATGGAATGGGG - Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121061899 14:90918814-90918836 CAGGATAGACAAATGATCAATGG - Intronic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121847365 14:97184745-97184767 CTGAAGAGAGAAAAGGAAAATGG + Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1123812243 15:23939251-23939273 TGGAAAAGACAAATGTACAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124827193 15:33109292-33109314 ATTAATAGATAAATGGCCAAAGG + Intronic
1125072553 15:35573359-35573381 CAGAGTAGAAAAATGGACACTGG + Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125909142 15:43420811-43420833 CTGAGGAGACCCATGGACAAAGG - Intronic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1127332135 15:57949762-57949784 CTACATAGATAAATGGCCAAAGG + Intergenic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1129415111 15:75372143-75372165 CTGGGTAGATAAATGGACCAAGG - Exonic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134068155 16:11242978-11243000 CTGAGTAGAGGAATGGAGAAGGG - Intergenic
1135422068 16:22312047-22312069 CAGAATAGGCAAATGTACAGAGG + Intronic
1135475103 16:22767382-22767404 CCCAATAGAAAAATGGTCAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137842030 16:51649654-51649676 CCGAATAGAAAAAAGGAGAATGG + Intergenic
1138073341 16:54015890-54015912 CAGGATAGAAAAATGGCCAAGGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1139151606 16:64388475-64388497 CTGAATTGTCAAGTGGACAGTGG - Intergenic
1140008221 16:71101505-71101527 CACAATAGAAAAATGGGCAAAGG + Intronic
1140572179 16:76120352-76120374 CTGAATGGACAAATAGAATAAGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142175841 16:88644859-88644881 CACAATAGAAAAATGGGCAAAGG + Intronic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143241753 17:5449352-5449374 CCCAGTAGAAAAATGGACAAAGG + Intronic
1143823271 17:9582476-9582498 CTCAATAGAAAAATGAGCAAAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144570416 17:16394548-16394570 CACAATAGGAAAATGGACAAAGG + Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1146788509 17:35738203-35738225 CCCAATAGAAAAATGGGCAAAGG - Intronic
1146904278 17:36608220-36608242 CTGCACAGACACAAGGACAAGGG - Intronic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1147535536 17:41319239-41319261 CCGAGTAGAAAAATTGACAATGG + Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1154227461 18:12519643-12519665 CTCATTAGAAAAATGAACAAAGG + Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156159645 18:34343945-34343967 CTCAAGAGTTAAATGGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157530633 18:48417802-48417824 TAGAACAGACAAATGCACAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159899593 18:74033335-74033357 CTTAATAGGAAAATGGGCAAAGG + Intergenic
1160264983 18:77334631-77334653 CTGAATAGAGCAAAGGCCAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162829146 19:13273468-13273490 CTCAATGGATAAATGGGCAAAGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167527278 19:49992686-49992708 CTTAGTAGGAAAATGGACAAAGG - Intronic
1167580642 19:50339834-50339856 CTCATTAGGAAAATGGACAAAGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167920710 19:52781010-52781032 CTGAGGAGACAACTGGACACAGG + Intronic
1167922580 19:52794075-52794097 CTGAGGAGACAACTGGACACAGG + Intronic
1167954953 19:53057168-53057190 TTGAAGAGACAATTGGACACAGG + Intergenic
1167970202 19:53184509-53184531 TTGAGGAGACAACTGGACAAAGG + Intronic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168499682 19:56883127-56883149 ATCAACAGATAAATGGACAATGG - Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925735271 2:6958317-6958339 CAGAACAGACACACGGACAAGGG + Intronic
926667036 2:15536955-15536977 CTGATTAGGCAAATGGAAACTGG - Intronic
927061347 2:19425234-19425256 ATGAAAAGAGAAATGAACAAAGG - Intergenic
927160928 2:20260107-20260129 CCCAAATGACAAATGGACAAAGG - Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927580098 2:24235705-24235727 CTGAATAGACATATCTCCAAAGG + Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929379530 2:41334095-41334117 CACAATAGACAAATGGGTAAAGG + Intergenic
929821705 2:45279382-45279404 CCCAAAAGAAAAATGGACAAAGG - Intergenic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930482798 2:51970512-51970534 GTGAATAGACAAATACATAATGG + Intergenic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
931957377 2:67442549-67442571 TTTGATAGAAAAATGGACAAGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933386374 2:81616124-81616146 CTGAAAAGACAAACGGACTGAGG - Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933808935 2:86020144-86020166 CCCAATAGAAAAATGGGCAAAGG + Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935012280 2:99146308-99146330 CCCAATAGAAAAATGGGCAAAGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937544341 2:122998535-122998557 CAAATTAGATAAATGGACAAAGG - Intergenic
937735695 2:125285690-125285712 CTGAACAGACAAATTACCAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939632550 2:144542950-144542972 CAGAATAGGCAAATTTACAAAGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942242862 2:173979561-173979583 CTCAATAGAAAATTGGATAAAGG - Intergenic
942657287 2:178227121-178227143 CCCACTAGAAAAATGGACAAAGG + Intronic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
944122451 2:196254903-196254925 CCCAATAGAAAAATGGATAAAGG - Intronic
945231103 2:207591234-207591256 CTGAAAGGAGAAATGAACAAAGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
946611027 2:221458108-221458130 CTGAAGAGTAAAATGGTCAAGGG - Intronic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169657524 20:7941863-7941885 ATTAAGAGACAAATGGATAAGGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172924259 20:38516673-38516695 CCTAGTAGATAAATGGACAAAGG + Intronic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173497717 20:43531314-43531336 CTGAACAGAGGAAAGGACAAGGG - Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174358526 20:50014102-50014124 CTGTAAAGAGACATGGACAAAGG + Intergenic
1174994855 20:55554849-55554871 CTGAATAGAAAAATGTAATAAGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177256256 21:18666607-18666629 CTTATTAGAAAAATAGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178027208 21:28481841-28481863 CAGAAAAGCCAAAAGGACAAAGG - Intergenic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180910400 22:19446150-19446172 CAGAATGGAAAAATGGCCAAAGG - Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182643454 22:31787957-31787979 CCTAATTGACAAATGGGCAAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953957894 3:47245643-47245665 CAGACCAGACAAAAGGACAAAGG + Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955422851 3:58756822-58756844 CTGAAAAGATAAAAGTACAAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
957617525 3:82550331-82550353 CTGTATTGACAAATAGCCAATGG - Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960221927 3:115122646-115122668 CTTCATAGACAAATGTTCAATGG - Intronic
960324343 3:116276869-116276891 CTGAATGGACCAATTAACAAGGG + Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961241043 3:125411898-125411920 CTGTATAGCCAAATGCATAATGG - Intergenic
961315217 3:126030349-126030371 CTAACTAGAAAAATGCACAAGGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
963180316 3:142348645-142348667 CAGCACAGACAAATGGACACTGG + Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964165268 3:153697197-153697219 GGGAATAGCCAAGTGGACAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
965924709 3:173963585-173963607 CTGAGAAGAAAAAAGGACAAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
966903187 3:184502118-184502140 CTCAGGAGAAAAATGGACAAAGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970943870 4:21667256-21667278 CTCCATAGACAAATGGGAAAAGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974970860 4:68824547-68824569 AGTAATTGACAAATGGACAAAGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978969021 4:114779920-114779942 CTCAACAGCCAAATGGATAAAGG - Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981305537 4:143243318-143243340 CCCAATAGAAAAATGGGCAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984264997 4:177487739-177487761 CTGAACCGACAAAGGAACAAGGG - Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986211577 5:5678481-5678503 GTGAAGAGAGAAATGGACACAGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986578683 5:9240319-9240341 CTGAATAGAGAACAGGATAAAGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986888992 5:12277160-12277182 CTGAATAGACTTATGGAAAGAGG + Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
989632502 5:43500278-43500300 CCTAATAGAAAAATGGGCAAAGG - Intronic
989997861 5:50857043-50857065 CTTAATAGATAAATGGAAACAGG - Intergenic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990349529 5:54901729-54901751 CTGAATGGCCAAATGGACTTAGG - Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992252412 5:74888532-74888554 CCCAATAGAAAAATGGGCAAAGG - Intergenic
992758740 5:79933214-79933236 CTTCAGAGGCAAATGGACAATGG + Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993172243 5:84433686-84433708 CTGATTAGGAAACTGGACAATGG + Intergenic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993458169 5:88149018-88149040 CTAAATAGTCAAATAGACATTGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
994521643 5:100845529-100845551 CTGAAAAGTCAAATAAACAAGGG + Intronic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995261143 5:110105932-110105954 CTGCATTGAGAAATGGACCACGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996548148 5:124702929-124702951 CTGAGCTGACAAATGAACAAAGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997090568 5:130851669-130851691 CTCAATAGAAATATGGGCAAAGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000667860 5:164021046-164021068 CTGAATAGAGGATTGAACAAAGG + Intergenic
1000813979 5:165898022-165898044 CATAAAAGATAAATGGACAAAGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010661353 6:78574024-78574046 CTGAATTGACATCTGGATAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1011991767 6:93529338-93529360 CTGAAAAGCCAAATGGAAAGAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1012973028 6:105751950-105751972 ATCAACAGACAAATGGATAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016201284 6:141412436-141412458 AAGAATAGTCAAATGGACCAAGG - Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016941894 6:149489262-149489284 CAGAATAGGAAAATGGGCAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021035882 7:15797621-15797643 CTGAAGAGAAAAATTGAAAAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022872705 7:34495999-34496021 CTGATTAGAAAAGTGGACAGGGG - Intergenic
1023190440 7:37574886-37574908 CTAAAAAGACAAATGACCAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1027971110 7:85083358-85083380 ATGCATGGACCAATGGACAATGG + Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1032241849 7:130167490-130167512 TTTATTAGAAAAATGGACAAAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036507714 8:9370513-9370535 GGGAATAGACAAATGGCGAAGGG + Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041435416 8:57834562-57834584 CAGAATAGAAAAATCTACAAAGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1043213723 8:77558866-77558888 CTGAATAGACATATTTCCAAGGG + Intergenic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044578149 8:93793684-93793706 CATAATAGAGAAATGGGCAAGGG - Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1047104075 8:121713918-121713940 CTGCACAGGCAAATGGACAGAGG + Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048915667 8:139180685-139180707 CTCAAGAGACAAATGACCAAAGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049976367 9:863868-863890 ATCAATAGAGAAATGGGCAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052713422 9:32086186-32086208 CTTAATTGAAAAATGCACAAAGG + Intergenic
1053195362 9:36113800-36113822 CCTAATAGAAAAATGGACCAAGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055498923 9:76884087-76884109 CAGAATAGGCAAATGGAGAGAGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060679981 9:125553628-125553650 CTACATAGACAAATGGGCATGGG - Intronic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1190871186 X:54426013-54426035 CCCAATAGAAAAATGGCCAAGGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191182730 X:57580116-57580138 CTCAATAGACAATTCGGCAAGGG + Intergenic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1192975741 X:76282585-76282607 CTTAATAGACTAATGCAAAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1195271816 X:103239313-103239335 CTAAAGAGTAAAATGGACAAGGG - Intergenic
1195654081 X:107317649-107317671 CCCAATAGACAAATGAGCAAAGG + Intergenic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1196090873 X:111740909-111740931 CTGAATAGCCAAATAGATGAGGG + Intronic
1196882040 X:120207386-120207408 CTTAATAGACCACTTGACAATGG + Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197129026 X:122982393-122982415 TTCAAAAGTCAAATGGACAATGG + Intergenic
1198668218 X:139047879-139047901 CCTAATAGATAAATGAACAAAGG - Intronic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199800078 X:151241718-151241740 CTCAATAGAAATGTGGACAAAGG + Intergenic
1200841794 Y:7789243-7789265 CTGAATAGACATATCACCAAAGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic