ID: 922370586

View in Genome Browser
Species Human (GRCh38)
Location 1:224906858-224906880
Sequence CAGAGTGGGCTGAGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922370579_922370586 16 Left 922370579 1:224906819-224906841 CCATGTGCATAAACTGTTCACCA 0: 1
1: 0
2: 0
3: 4
4: 158
Right 922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG 0: 1
1: 0
2: 2
3: 25
4: 333
922370581_922370586 -4 Left 922370581 1:224906839-224906861 CCACTGCTGCAGGTGACTTCAGA 0: 1
1: 1
2: 5
3: 24
4: 188
Right 922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG 0: 1
1: 0
2: 2
3: 25
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922370586 Original CRISPR CAGAGTGGGCTGAGGGAATA TGG Intronic
900422223 1:2560582-2560604 CAGAGGGGGCTGAGGGCACCAGG - Intronic
900431034 1:2603339-2603361 GAGAGTCGGCTGAGGGAGTGGGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
903498239 1:23786410-23786432 GAGAGTGGACTGAGGTAAGATGG + Exonic
903678554 1:25082149-25082171 CAGAGCCTGCAGAGGGAATATGG + Intergenic
904232148 1:29084166-29084188 CAGAGATGGCAGTGGGAATAGGG - Intronic
904299123 1:29542820-29542842 CTGAGAGGGCTGAGGGAAGCTGG + Intergenic
904477608 1:30775111-30775133 CAGCCTGGGGTGAGGGAATGGGG + Intergenic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
905864462 1:41369131-41369153 CAAGGTGGGCTGAGGGCCTATGG - Intronic
906066505 1:42984836-42984858 GAGATGGGGCTGAGGGAAGAAGG + Intergenic
907416942 1:54321053-54321075 CACAGTGGCCTAAGGGAACATGG + Intronic
908755099 1:67462513-67462535 CAGAGTGGGTTGATGGGTTAGGG - Intergenic
911445222 1:97984119-97984141 CAAAGTGGTAGGAGGGAATAAGG - Intergenic
911945090 1:104097025-104097047 CATAGAGGGCTGAGAGACTAAGG - Intergenic
913668631 1:121073700-121073722 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914020375 1:143861143-143861165 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914658875 1:149769055-149769077 CTGAGTTGACTAAGGGAATAAGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915915994 1:159941399-159941421 CAGAGCCGGCTGAGGGAGTTGGG - Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
916966184 1:169945121-169945143 CAGAGGGGGCTGAGGCAGTGGGG + Intronic
917083201 1:171278130-171278152 CAGAGTTGGCTCAGAGAAAAAGG - Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
919186251 1:194154464-194154486 CATTTTGGGCTGAGGGAATACGG + Intergenic
919239147 1:194889404-194889426 CAGAGGGGACTGAGGCAGTAGGG - Intergenic
919981838 1:202646747-202646769 GACAGAGGGCTGAAGGAATAAGG + Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
922106987 1:222521064-222521086 CACAGTGGTGTGAGGGAACAGGG - Intergenic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
923133412 1:231096766-231096788 CAGAGGTGGCTGAGGGGACAGGG + Intergenic
923137532 1:231131497-231131519 CAGAGGGTGCAGAGGTAATAAGG - Intergenic
923276245 1:232399474-232399496 CAGAGTGGGATGAAAGAACAGGG - Intronic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
924161818 1:241240844-241240866 CAGAAAGGGCTCAGGGAGTAGGG - Intronic
1064091474 10:12389226-12389248 CAGAGGGGGCTGAGGGGCTTGGG + Intronic
1064335298 10:14435184-14435206 CAGGGTGGGATGAGGGCAAAAGG + Intronic
1064560045 10:16586874-16586896 CAGAGTGTGATGTGGGATTAAGG + Intergenic
1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG + Intronic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067412903 10:46080091-46080113 CAGGGAGGGCTGAAGGGATATGG - Intergenic
1067546631 10:47196725-47196747 GAGACTGGCCTGAGGGTATAGGG - Intergenic
1068213531 10:53952803-53952825 CAGAGTGGGCTGAGGTGGCAAGG + Intronic
1070201245 10:74207993-74208015 CAGAGGGGGCTGAGGGGGCAGGG + Intronic
1070596860 10:77838552-77838574 CTGAGTGGGCTGAGGCAAAGAGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073093444 10:100965189-100965211 TGGGGTGGGCTGAGGGAACAGGG - Intergenic
1075179466 10:120196822-120196844 AAGAGTTGGCTGTGGGAATATGG + Intergenic
1077328450 11:1973619-1973641 CAGAGGGGGCTGTGGGGAGAGGG + Intronic
1078663266 11:13304179-13304201 GAGAGTGGACTGAGGGAGCAAGG + Intronic
1079029258 11:16973703-16973725 CAGGGTGGGCTCAAGGCATAGGG - Intronic
1079184178 11:18221417-18221439 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1081038279 11:38177226-38177248 CAGGGTGGGCTGAGCGAACAGGG + Intergenic
1081284071 11:41246252-41246274 CAGAGTGGGCTGATGCAGCAGGG + Intronic
1081589147 11:44408853-44408875 AGGAGTGGGCAGAGGGAATGTGG + Intergenic
1082751722 11:57026114-57026136 CAGAGAGAGCTGAGAGAAAATGG - Intergenic
1083135853 11:60676403-60676425 CCCAGTGGGCTGAGGGAGTGGGG + Intergenic
1083372364 11:62192490-62192512 CAGAGTGTGCTGAGGACATGGGG + Intronic
1083378252 11:62243719-62243741 CAGAGTGTGCTGAGGACATGGGG + Intronic
1083384495 11:62297350-62297372 CAGAGTGTGCTGAGGACATGGGG - Intronic
1083636789 11:64125147-64125169 GAGGGTGTGCTGAGGGCATAGGG + Intronic
1085879911 11:80454463-80454485 CAGAGAGGGCTCAGAGGATAGGG - Intergenic
1088844511 11:113653434-113653456 CAGAGTGTGCTGAGGGACTTGGG - Intergenic
1089341755 11:117763037-117763059 CAGAGTGGTCTGTGGGAGGAAGG - Intronic
1202811428 11_KI270721v1_random:28798-28820 CAGAGGGGGCTGTGGGGAGAGGG + Intergenic
1093037301 12:14344781-14344803 AAGAATGGGCAGAGGGAAAAGGG - Intergenic
1097683857 12:62674225-62674247 AAGAGTGGGCTCAGGGAAACTGG + Intronic
1099936912 12:89137320-89137342 CAGAGTGGGCTCAGAGACTCCGG - Intergenic
1100315751 12:93442578-93442600 CAGGGTAGGCTGAAGGAAAAGGG + Intergenic
1102193972 12:111011311-111011333 CAGAGTGGGATGTGGGAAGGTGG + Intergenic
1102348115 12:112172505-112172527 AAGAGTGGGCTGACGAAACAGGG - Intronic
1102520230 12:113473072-113473094 GAAAGGGGGCTGAGGGAGTAGGG + Intergenic
1102846909 12:116194917-116194939 GAGAGTGGGCAGAAGGTATAGGG + Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1105041808 12:132966937-132966959 CAGAGGGGGCTGAGGCAGCAAGG - Intergenic
1105428116 13:20313177-20313199 CTGAGTGGGATGAGGGATGAAGG + Intergenic
1108017070 13:46086832-46086854 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1108690289 13:52853381-52853403 CAGAGAGGAATGAGGGAATTGGG - Intergenic
1109762266 13:66845296-66845318 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1110570225 13:76994826-76994848 CACAGTGGGATCAGGGAACAGGG + Intronic
1110810593 13:79807659-79807681 CAGAGGGGGCTGAGGTAGCAGGG - Intergenic
1112260809 13:97876334-97876356 CAGAGTGGGGTGCTGGAAAACGG - Intergenic
1112390183 13:98976147-98976169 CAGAGAGGGGTGAGGGAGTGAGG - Intronic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113488876 13:110676696-110676718 CAGAGAAGGGTGAGGGAACAGGG + Intronic
1113882878 13:113637470-113637492 CAGGATGGGCTGTGGGAAGAGGG + Intronic
1115446242 14:33493567-33493589 CACAGCGGGCTGAGGTAACATGG - Intronic
1116425089 14:44781177-44781199 CAGAGTGGGCTGGGGGATTTAGG + Intergenic
1117930829 14:60838929-60838951 CAGAGGGGGCTGAGGTGACAGGG - Intronic
1118947076 14:70398474-70398496 CAGAGAGGGCTGAGGCAGCAAGG + Intronic
1119949849 14:78733530-78733552 CAGAGTGGTCAGAGGTAACAAGG + Intronic
1120440773 14:84536128-84536150 CACAGGGTGCTGAGGGAAAAAGG - Intergenic
1121034309 14:90687502-90687524 CAAAGTGGACTGGGGGAAGAGGG + Intronic
1122080663 14:99264994-99265016 CTGAGTGGGATCAGGGAGTAGGG + Intronic
1122865603 14:104602656-104602678 TGGAGTGGGCTGAGGGAAGGAGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124693616 15:31845709-31845731 CAGAGTGGGTAGAGGGTACAGGG - Intronic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1124930558 15:34115330-34115352 CAGAGTGGGCTGAGTAAATGGGG + Intergenic
1125760151 15:42090751-42090773 TAGAGGAGGCTGAGGGAAAAGGG + Intronic
1125760571 15:42093340-42093362 TAGAGCAGGCTGAGGGAAAAGGG + Intronic
1129177856 15:73852912-73852934 CAGAGTGGGGTGAGGGAGCTGGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1132993106 16:2807556-2807578 CGGGGTGGGGTGATGGAATAAGG + Intergenic
1134078471 16:11308695-11308717 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1134308548 16:13055676-13055698 CAGAGTGCTATGAGGGAAGAGGG - Intronic
1136551561 16:30985027-30985049 CAGAGTGGGCTGAAGGGGTCTGG - Exonic
1137343834 16:47636652-47636674 CAGAGGGGGCTGAGGCAGCAGGG - Intronic
1138413792 16:56859631-56859653 GAGAATGGGCTGAGGGAGAAGGG - Intergenic
1139318288 16:66092104-66092126 CAGAGTGGGCTGAGGGGTTCTGG - Intergenic
1140039693 16:71397800-71397822 CACAGTTGGCTGTGGGAAAATGG + Intergenic
1140328210 16:74026661-74026683 CAGAGAGGGCTGAGGAAGGAAGG + Intergenic
1140606926 16:76550093-76550115 CATAGTGTACTAAGGGAATAGGG + Intronic
1141009641 16:80385536-80385558 CAGTGTGGGGTTGGGGAATAGGG + Intergenic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142324909 16:89408485-89408507 CAGAGCAGGGTGAGGGAATCTGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142927688 17:3255382-3255404 CAGGGTGGGGTGGGGGACTAGGG + Intergenic
1143201773 17:5118243-5118265 CACAGTGGGCTGAGTAAACAGGG - Exonic
1143203240 17:5126607-5126629 CAGAGGAGGCTGAGAGGATAAGG - Intronic
1143542784 17:7579602-7579624 AAGAGAGGGCTGAGGGAGCAGGG + Exonic
1144034190 17:11350591-11350613 GACAGTGGACTGAGGGAAGAGGG - Intronic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148778826 17:50110482-50110504 CTTTGTGGGCTGGGGGAATAAGG - Exonic
1149848752 17:60022546-60022568 CAGAGGAGGCTGAGAGGATAAGG + Intergenic
1149861416 17:60123978-60124000 CAGAGGAGGCTGAGAGGATAAGG - Intergenic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1150309282 17:64114546-64114568 CAGAGAAGGCAGAGGGGATATGG + Intronic
1150840347 17:68600903-68600925 CCGAGTGAGCCGAGGGAATGGGG + Exonic
1150920605 17:69478270-69478292 CTGAATGAGCTGAGGGAATGGGG - Intronic
1151871527 17:76840234-76840256 CGGAGTGGGCTGAGGCAGTGGGG - Intergenic
1152365626 17:79854707-79854729 CAGCGTGGGCTGGGGGAGTGGGG + Intergenic
1152430643 17:80246722-80246744 CAGAGGGGGCTGCAGGAAAATGG - Intronic
1156247647 18:35317646-35317668 CAGAGTGGGCAGATGCAGTAAGG - Intergenic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1158237730 18:55338114-55338136 CAGAATGGGCTAAGGGAAGCAGG - Intronic
1159770114 18:72539123-72539145 CAGGGAGGTCTGTGGGAATATGG + Intronic
1160225850 18:77009940-77009962 CAGAGTGGGCTGCGTGAGTCCGG + Intronic
1160994000 19:1873457-1873479 CAGAGTGGGCCTAGGCCATAGGG + Intergenic
1161781750 19:6297686-6297708 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1163598081 19:18231974-18231996 CAGGGTGGGGTGAGGGAGTGGGG + Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1166998489 19:46731216-46731238 CTGACTGGGCTGTGGGAATGGGG - Intronic
1167080767 19:47274903-47274925 CCGAGTGGGCTGCGGGGATGCGG + Exonic
1168014418 19:53560754-53560776 CAGAGTGGTGTGACGGAAAAAGG - Intronic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
928237119 2:29553248-29553270 CAGAAGGGGCTAAGGGAAAAAGG - Intronic
928504376 2:31934669-31934691 CAGAGTCAGGTAAGGGAATAGGG + Intronic
932547128 2:72724878-72724900 CAGAGAGGGCTGAGGGGGTGGGG + Intronic
933793653 2:85903433-85903455 CAGAGAGGTCTGAGGGAAAGGGG + Intergenic
934696591 2:96404734-96404756 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
936639716 2:114298443-114298465 CAGAGTGGGCTAAGGGAAATAGG + Intergenic
937125273 2:119471406-119471428 CAGAGTGGGATGATTTAATAAGG - Intronic
937539530 2:122931426-122931448 TATAGTGGGGTGAGGGAATGGGG + Intergenic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939106845 2:137958847-137958869 CAGAGTGGTGAGAGGTAATATGG + Intergenic
940422882 2:153499662-153499684 CAGAGGGGGCTGAGGGGGCAGGG + Intergenic
941151023 2:161915754-161915776 CAGGGTGGGCTGAGTAAATGGGG + Intronic
941452914 2:165680826-165680848 CAGAGGAGGCTGAGGAAACATGG + Exonic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
945079182 2:206071693-206071715 AAGAGTGAGCTGATGGAATCAGG - Intronic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
945770455 2:214035490-214035512 CAGAGGGGGCTGAGGCAACAGGG + Intronic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
946803038 2:223441708-223441730 CAGAGTTGGGAGAGGGAATGGGG + Intergenic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
948630238 2:239297710-239297732 CAGAGGGTGCTGAGGGGATGGGG - Intronic
949080144 2:242089435-242089457 CAGAGTGGCCTGGAGGAATGAGG - Intergenic
1169091221 20:2862436-2862458 TTGAGTGGGCTGAGGGAGTTGGG + Intronic
1169334978 20:4748611-4748633 CAGCCTGGGCTGAGGCCATATGG + Intergenic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1172663004 20:36580192-36580214 CAGAGTGGGATAAGGGAAGGAGG - Intronic
1173115660 20:40240580-40240602 AGGGGTGGGCTGAGGGAATATGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175312926 20:58024364-58024386 CAGAGGGGGCTGAGGGCAGCAGG + Intergenic
1175776621 20:61657997-61658019 CAGAGTGGATTAAGGGAACAGGG + Intronic
1177189824 21:17838627-17838649 CAGAGGGGGCTGATGGCATTGGG - Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1179903499 21:44407005-44407027 CAGAGTGGGCCGAGGGCACCTGG + Intronic
1181283939 22:21739017-21739039 CTGAGTGGGCTGTGGGAAAGTGG - Intergenic
1181911680 22:26243401-26243423 CAGAGAGAGCTGAGTGAATGAGG + Intronic
1182386424 22:29945780-29945802 TAAAGTGGGATGAGGGAATCAGG + Intronic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183414217 22:37673382-37673404 CAGAGTGGGCTTTGGGCATCTGG + Intergenic
1184242234 22:43217318-43217340 AAGAGTGGGCTGCGGGGATGGGG - Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184723668 22:46330566-46330588 GAGGGTGGGCTGAGGGACTGGGG + Exonic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184969667 22:48006885-48006907 CAGCGTGTGCTTAGGGAAAATGG + Intergenic
1185381812 22:50512277-50512299 CATAGTTGGCTGAGAAAATACGG + Intronic
950019758 3:9779013-9779035 CAGACTGGTCTGAGAGAATCAGG - Intronic
951718528 3:25674092-25674114 CAGAGGGGGCTGAGGCATCAGGG + Intergenic
951969573 3:28429010-28429032 CAGAGTGGGCTGCTGCTATAAGG + Intronic
952255373 3:31690592-31690614 AATTGTGGACTGAGGGAATATGG + Intronic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
953187605 3:40653141-40653163 CACACTGGGCTGAGGGCAGATGG + Intergenic
954581576 3:51706127-51706149 CAGACTGTGCTGAAGGAATGGGG - Intergenic
955231322 3:57101483-57101505 CAGAGGGGGCTGATGGAGTTGGG - Intronic
956805640 3:72808324-72808346 CAGAGTGGGTTGTGGGAAAGTGG - Intronic
956863249 3:73345425-73345447 CACAGTGGGCAGAAGGAACAGGG + Intergenic
957007595 3:74968380-74968402 CAGATTGGGCAGAGGGTATGTGG + Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957614471 3:82509416-82509438 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
959963372 3:112327037-112327059 CAAAGGGGACTGAGGGATTAAGG + Intergenic
960023169 3:112978294-112978316 CAGAGTAGATTGAGGGAATTAGG - Intergenic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961470811 3:127110380-127110402 CAGAGATGGGTGAGGGAAGAAGG + Intergenic
962251314 3:133837820-133837842 CAAAGTGGGGTGAGGGGCTAGGG + Intronic
962350820 3:134654526-134654548 CAGGGTAGGCTGAGGGAGTTAGG - Intronic
963028925 3:140947339-140947361 CAAAATAGGCTGAGGGAATGTGG - Intronic
963542991 3:146618032-146618054 TGGAGTGGGTTGAGGGAGTATGG - Intergenic
964009037 3:151867296-151867318 CAGAGTGGTTAGAGGGGATACGG - Intergenic
965680479 3:171246130-171246152 CAAATTAGGCTCAGGGAATAAGG - Intronic
966199610 3:177348286-177348308 CAGGGTGGGCTGGGGGAAAGAGG + Intergenic
966761718 3:183425329-183425351 CAGAGGAGGCCGAGTGAATACGG + Intronic
967115542 3:186334275-186334297 CAGGGTGGGGTGGGGGAATATGG - Intronic
968542218 4:1173335-1173357 CAGAGTGGGCTGAGGGTCTGGGG + Intronic
968936274 4:3612128-3612150 CAGAGTGGGCTTGGGGAGCAGGG - Intergenic
969194121 4:5547228-5547250 CAGAGGGGGCTGAGGCAGTGGGG - Intronic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
969213052 4:5702240-5702262 CAGAGTGGTCTGAGAGATGAGGG - Intronic
970593696 4:17580528-17580550 GAGGGTGGGCTGAGGAAATCTGG - Intronic
971371642 4:26024073-26024095 CAGGGTAGGCTGAGGGGATTTGG + Intergenic
978857159 4:113406340-113406362 TATAGTGGGCTGGGGGTATATGG - Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
982138399 4:152294588-152294610 CAGAGAAGGCTGGGGAAATAAGG + Intergenic
982243535 4:153325259-153325281 CACAGTGGGCTGCGGAAATGGGG + Intronic
982610973 4:157574513-157574535 CAGAGTGGACTCTGGGAGTAGGG - Intergenic
985933577 5:3078207-3078229 CAGGGTGGGCTTAGAGAAAAAGG + Intergenic
986004202 5:3654410-3654432 CAGAGTGGGGAGAGGGACTTTGG + Intergenic
986189585 5:5482681-5482703 TAGTGTGGGCTGAGGGCAAAGGG + Intronic
986806307 5:11311806-11311828 GAGTGTGGGCTGAGGGTGTATGG - Intronic
988940338 5:36139271-36139293 CAGAGTGGGCTGAGGCAGCCGGG - Intronic
989268283 5:39502880-39502902 CAAAGGGGGCTGAGGGAAGCAGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
991410359 5:66339457-66339479 CAGAGGGGGCTCAGTGCATAAGG - Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
991694462 5:69257196-69257218 CAGAGGGGCCTCAGGGAATTTGG + Intronic
995247195 5:109947833-109947855 CAGGAATGGCTGAGGGAATAGGG + Intergenic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
997077246 5:130693910-130693932 CAGCGTGGGGTGAGGGGATTTGG + Intergenic
997583220 5:135030187-135030209 CCGAGTGGGCAGAGGGCATGCGG - Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001208931 5:169792069-169792091 GAGACTGGCATGAGGGAATAAGG + Intronic
1001533937 5:172485367-172485389 CAGAATGGCCTCAGGGAATTTGG + Intergenic
1001854082 5:174995630-174995652 GAGAGAGGGGTGAGGGAATGAGG + Intergenic
1002520956 5:179793102-179793124 CAGAGTGGGGAGGGGGACTACGG - Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1003338728 6:5199360-5199382 AAGAGTGGGTTGGGGGAAAATGG + Intronic
1004419722 6:15458135-15458157 CAGAGTGGTGACAGGGAATACGG - Intronic
1004801219 6:19150586-19150608 CAGAATGGGGTGATGGAATGTGG + Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1005986905 6:30881315-30881337 GTGAATGGGCTGAGGGACTAGGG + Intronic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1008929954 6:56928339-56928361 CACAGTGGGCTGCGTCAATAGGG - Intronic
1009055877 6:58334437-58334459 CAGAGTGGTCTGAAGGAGTTTGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011744469 6:90396328-90396350 CAGTGAGCGCTGAGGGCATATGG + Intergenic
1012918289 6:105194717-105194739 CAGGGTGGGATGAGAGAATGTGG + Intergenic
1013553802 6:111236241-111236263 AAGAGTGGGGTGAGGGATAAAGG + Intergenic
1014107497 6:117583244-117583266 CAGGGTGGGCTGAGTAAACAGGG + Intronic
1014268815 6:119313110-119313132 CAGAGTGGGCAGAGCAATTACGG + Intronic
1014828870 6:126077984-126078006 CAGACTGGGGTTTGGGAATATGG + Intergenic
1015434670 6:133172379-133172401 CAGAGGGGGCTGAGGCCACAGGG - Intergenic
1017352840 6:153463390-153463412 AATAGTGGGCTGGGGGAAGAGGG + Intergenic
1017537881 6:155367798-155367820 TAGAGTGGGCAGAGGGGTTATGG + Intergenic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1018197522 6:161368052-161368074 CAAAGAGGGCTAAGGGACTAAGG + Intronic
1018510213 6:164516862-164516884 GAGAGTGGGCTGCGGCAATAAGG - Intergenic
1018641982 6:165912456-165912478 CAGAATGGGCTGAAGCAAGAAGG - Intronic
1021686110 7:23188027-23188049 CAGAAAGGGCTTAGGGACTATGG - Intronic
1022379408 7:29845705-29845727 CAGAGTCGGATGAGGGATGAGGG + Intronic
1022423510 7:30246225-30246247 CAGAGGGGGCTGAGGGAGCAGGG + Intergenic
1022720656 7:32939448-32939470 CAGAGTGGACTGATGGAGTCAGG + Intergenic
1022850276 7:34254734-34254756 CAGAGTGGGCTTTGAGAATTGGG - Intergenic
1023293366 7:38690138-38690160 CAGAGTTGCCTGAAGGAATCTGG + Intergenic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1023965449 7:44961377-44961399 CTGAGGGGGCTGAGGGGATGAGG + Intergenic
1023972165 7:44999825-44999847 CTGAGTGGGCGGAGCGAACAGGG + Intronic
1024776701 7:52795907-52795929 TGGAGTGGGGTGAGGGAAAAAGG + Intergenic
1027197118 7:76038280-76038302 CAGAGAGGTCTGAAGGAATGTGG + Intronic
1028054619 7:86226369-86226391 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030231115 7:107209244-107209266 CAGAGTGGGTTTGAGGAATAAGG + Intronic
1031859037 7:126957653-126957675 CAGAGGGGGCTGAGGCAGCAGGG - Intronic
1032982510 7:137300223-137300245 CAGAGTGGCCTTAGGGCCTAAGG + Intronic
1033286894 7:140049202-140049224 CTGAGAGGACTGAGGGAACAAGG + Intronic
1033478105 7:141710358-141710380 GAGAATGGGCTGAGAGAATGTGG + Intronic
1033695018 7:143779819-143779841 GAGAGTGGGCGGAGGGAGAAAGG + Intergenic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035162442 7:156961050-156961072 CAGAGTGGGCTGAAGGGATATGG + Intronic
1035538186 8:407698-407720 CAGAGTGGCCTGGAGGAATGAGG - Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037002230 8:13733795-13733817 GAAAATAGGCTGAGGGAATAAGG + Intergenic
1037649864 8:20826467-20826489 CACTGTGGGCTGAGGAAATCAGG + Intergenic
1038546723 8:28431283-28431305 CAAGATGGGCTGAGGGAAGATGG + Intronic
1039387697 8:37151005-37151027 AAGAGTGGGCTGAGGTGAAATGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1039833723 8:41238101-41238123 CAGAGTAGCCTGAGTAAATACGG + Intergenic
1040572533 8:48623392-48623414 GAGTGTGGGCTGGAGGAATAGGG + Intergenic
1041205559 8:55495088-55495110 CAGAGCGGGCTGAGGTAGCAGGG + Intronic
1041389880 8:57338796-57338818 AAGAGTGTTCTGAGGGACTAAGG - Intergenic
1041955998 8:63558717-63558739 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
1045277322 8:100720669-100720691 CAGAGTGGGAGGAGGGGATGTGG - Intronic
1045611490 8:103848008-103848030 GGGAGTGGGCTGAGGGTATGTGG - Intronic
1045972864 8:108099471-108099493 CAGAGTATGATGAGAGAATAGGG + Intergenic
1046503811 8:115111730-115111752 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1047104724 8:121720092-121720114 CAGAGGGGGCTGAGGCAGCAAGG + Intergenic
1048474630 8:134732308-134732330 CATAGTGGGATGAGGGGAGAGGG + Intergenic
1048987575 8:139743018-139743040 CAGAGTGGGCTGAGAGGAGCAGG + Intronic
1049124531 8:140774994-140775016 CAGTGTGGGCTGCTGGACTAAGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049702850 8:144022966-144022988 AAGAGGGTCCTGAGGGAATAGGG - Intronic
1055624603 9:78162815-78162837 CAGAGAAAGCTGAGGAAATAAGG + Intergenic
1055730639 9:79276495-79276517 CAGACAGTGCTGAGGGAATCTGG + Intergenic
1055781769 9:79828615-79828637 CAGAGAGGGCTGGGTGAATCTGG + Intergenic
1057700057 9:97357396-97357418 CAGAGTGTGGTGAGGGAGTTGGG - Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1060153689 9:121304347-121304369 CAGAAAGGGCTGTGGGAAGAAGG - Intronic
1060277530 9:122193200-122193222 CATAGTGTGCTGAGGCACTATGG - Intronic
1060446414 9:123692381-123692403 AAGAGTGGGCTGGGCCAATAGGG + Intronic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061560219 9:131397265-131397287 CACAGTGGGCTTAGGGCCTAAGG - Intronic
1061703370 9:132433356-132433378 CAGAGTGTGGTAAGGGAAGAAGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062640973 9:137518253-137518275 CAGAGTGGAGTGAGTGAATGAGG - Intronic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190621048 X:52287563-52287585 CAGAGGGGCCTGAGGGAGCAAGG - Intergenic
1190843567 X:54169569-54169591 TAGAGGGGCTTGAGGGAATATGG - Intronic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1197611439 X:128643482-128643504 GAGAGTAGGGTGAGGGAATGAGG - Intergenic
1199106260 X:143872872-143872894 CAGAGAGGGGTGGGGGAAGATGG + Intergenic
1200213418 X:154356885-154356907 CTGCGTGGGCTGAGGGAACAAGG - Intronic