ID: 922379096

View in Genome Browser
Species Human (GRCh38)
Location 1:225003358-225003380
Sequence TATAAGATAGCTCTTTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922379095_922379096 2 Left 922379095 1:225003333-225003355 CCTGTTAATGGAATAACTTAATT 0: 1
1: 0
2: 1
3: 16
4: 249
Right 922379096 1:225003358-225003380 TATAAGATAGCTCTTTTGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 148
922379093_922379096 30 Left 922379093 1:225003305-225003327 CCTATTTCAAGATTCTAGAAAAA 0: 1
1: 0
2: 6
3: 151
4: 1474
Right 922379096 1:225003358-225003380 TATAAGATAGCTCTTTTGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922379096 Original CRISPR TATAAGATAGCTCTTTTGAG TGG Intronic
909215523 1:72882836-72882858 AATAAAATATCTGTTTTGAGAGG - Intergenic
911466889 1:98265735-98265757 TATAAGAAAGATCTTCAGAGAGG + Intergenic
912183535 1:107247717-107247739 TATAAGATAACTCATTTGTTAGG - Intronic
912259655 1:108097765-108097787 TATGAGATTTCTCTATTGAGTGG + Intergenic
912400778 1:109389982-109390004 AAAAAGATAGCTCTTTTGTGGGG - Intronic
913405437 1:118485853-118485875 AATTTGATAGCCCTTTTGAGTGG + Intergenic
913541499 1:119825475-119825497 TAGAAGATAAGTCTTTTGTGGGG + Intergenic
915542011 1:156573368-156573390 TATAAGATGGCTCTTTTTAAAGG - Intergenic
919346122 1:196381483-196381505 TATATCATAGAACTTTTGAGAGG - Intronic
920797952 1:209158718-209158740 TTTAAGATAGCTATTTAGAAGGG + Intergenic
922379096 1:225003358-225003380 TATAAGATAGCTCTTTTGAGTGG + Intronic
923582458 1:235231398-235231420 TATAAAATAGCTCTTATGGTAGG - Intronic
1063545675 10:6979000-6979022 TCTAAAAGAGCTCTTTTGATAGG - Intergenic
1063878607 10:10507773-10507795 TATAAAATAGCACTTTTGGGAGG + Intergenic
1065280928 10:24137030-24137052 AATAAGGTAACTCTTTTGAAGGG + Intronic
1068176836 10:53471721-53471743 TATAAAATAGCTCTTTTCTCCGG + Intergenic
1071790188 10:88945677-88945699 TATCATATAGCTTTTTTCAGTGG + Intronic
1073491048 10:103853883-103853905 TACAAGAAAGCTCTTTTTGGAGG - Intronic
1075139298 10:119817327-119817349 TATTAAATAGTTCTTTTGGGTGG + Intronic
1075743977 10:124713462-124713484 TATCAGATAGCTGTGTTCAGCGG - Intronic
1075959973 10:126560016-126560038 CATAAGCTGGCTCTTATGAGAGG - Intronic
1080133267 11:28821417-28821439 TAATAGATAGCACTGTTGAGTGG + Intergenic
1080430813 11:32197753-32197775 TATAAGATACTTCTTTAGAGAGG - Intergenic
1085892922 11:80602673-80602695 TATATGAAAATTCTTTTGAGAGG + Intergenic
1086542953 11:87934456-87934478 TATAAAATAACACTTTTGGGTGG - Intergenic
1088220291 11:107563605-107563627 TCTAAAATAGCTCCTTTGAAGGG - Intronic
1092766619 12:11858981-11859003 TATATGATTGCTTTATTGAGGGG + Intronic
1095165130 12:38963371-38963393 TCTAAGAAAGATATTTTGAGGGG - Intergenic
1098355213 12:69606036-69606058 TATATAATAGCTCTTTTCAAAGG + Intergenic
1099083036 12:78210299-78210321 GATAAGATAGCTCTTCGGTGTGG + Intronic
1099563566 12:84210857-84210879 TATAATGTAGAACTTTTGAGAGG + Intergenic
1100646766 12:96539818-96539840 TATAAAGTAGCTCTTTTAAATGG - Intronic
1101558035 12:105829533-105829555 TATAAGCTAGCTATTGTGAGTGG + Intergenic
1104334230 12:127878375-127878397 CATAAGATAGCTCTGTTGAGGGG - Intergenic
1109231616 13:59764483-59764505 TTTAACATATCTTTTTTGAGGGG - Intronic
1111072818 13:83190650-83190672 GAAAAGATAGCCCTTTAGAGTGG + Intergenic
1113529116 13:111007173-111007195 TCTCAGGTAGCTCTTTTTAGCGG - Intergenic
1115370814 14:32612078-32612100 TTTAGGAAATCTCTTTTGAGAGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119476588 14:74933900-74933922 TATAAGACAGATTTTTTGGGGGG + Intergenic
1120034882 14:79685492-79685514 TATAACATGGCCTTTTTGAGAGG + Intronic
1120197327 14:81499205-81499227 TATCAGATCTCTCTTTTTAGGGG + Intronic
1122573951 14:102729360-102729382 TGTAATATAGCTCTTTTAACTGG + Exonic
1124151285 15:27180832-27180854 CATAAGATAGACCTTTTCAGTGG - Intronic
1126495856 15:49289944-49289966 TATCAGATACCACTTCTGAGAGG - Intronic
1128957200 15:71960773-71960795 TATGTGATACCTCTTTGGAGAGG - Intronic
1134347821 16:13407494-13407516 TTTAACATATCTATTTTGAGGGG + Intergenic
1136933939 16:34441578-34441600 AAAAAAATAGCTTTTTTGAGGGG + Intergenic
1136970633 16:34970236-34970258 AAAAAAATAGCTTTTTTGAGGGG - Intergenic
1137390829 16:48080173-48080195 TATAAGCTTCCTCTTTGGAGGGG - Intergenic
1137741604 16:50781561-50781583 TATAAGAAAGTTGTTTTAAGAGG + Intronic
1138064341 16:53924933-53924955 TTTAAGATGGCTCTTTTGTGAGG - Intronic
1138663282 16:58539504-58539526 TAAAAGGTAGCCCTTTAGAGGGG - Intronic
1139183430 16:64773892-64773914 TTTCAGATAACTCTTTTAAGTGG + Intergenic
1144320204 17:14109659-14109681 AATAAGACATCTCATTTGAGAGG - Intronic
1145393922 17:22478881-22478903 TTTGAGATGGCTCTTTAGAGGGG - Intergenic
1149714877 17:58778843-58778865 TAAAGGATGGCTCTTTGGAGTGG - Intronic
1150925561 17:69528361-69528383 TAGAAGATATATCTTTTAAGAGG - Intronic
1151110860 17:71676029-71676051 AAGAAGATAGCTCTTTTTTGAGG + Intergenic
1154959986 18:21298583-21298605 TATAAAATAGCTATTTTCAAGGG + Intronic
1155319037 18:24600276-24600298 TATACGAAAACTCTTTTGTGAGG + Intergenic
1156842563 18:41627124-41627146 TATAAAAAAGGTCTTTAGAGAGG - Intergenic
1164149244 19:22534609-22534631 TATTAGAATTCTCTTTTGAGTGG - Intergenic
1168567908 19:57440101-57440123 TATAAGGAAGGGCTTTTGAGGGG + Intronic
926241248 2:11087990-11088012 TTTAAGAGCTCTCTTTTGAGAGG + Intergenic
928790598 2:34947723-34947745 AATCAGATAGCTATTTAGAGGGG + Intergenic
929366888 2:41169730-41169752 GATAAAATAGGTCTTTTCAGTGG + Intergenic
930745203 2:54875451-54875473 TAGGAGTTAGCTCTTTTGGGGGG + Intronic
931411202 2:62033723-62033745 TATTAGATAGCACATTAGAGAGG + Intronic
931453390 2:62387526-62387548 TATAAGGCAGCTCTCTTGACTGG + Intergenic
931669589 2:64635291-64635313 TATGAGATAGCTATTTTGATAGG - Exonic
933450130 2:82438521-82438543 TATAAGATAGCAGTTTGGAAAGG - Intergenic
936907838 2:117557494-117557516 CAGAAGATAGCTCTTTCTAGAGG - Intergenic
939400371 2:141684709-141684731 TTTAGGAAAGCTCTTTGGAGGGG + Intronic
939586754 2:144015232-144015254 TCTTAGAGAGCTCTTTTTAGGGG - Intronic
940813732 2:158275298-158275320 TATAAGATAGCTCTGATGACAGG + Intronic
941427472 2:165367064-165367086 TTTAAGATAGCTTTTGTAAGCGG + Intronic
942771008 2:179520272-179520294 TATAAAATTGACCTTTTGAGGGG - Intronic
943606970 2:189987452-189987474 TATAAGTAAGATCTTGTGAGAGG + Intronic
944297609 2:198084749-198084771 TATTAGATAGGTGTTATGAGAGG - Exonic
944609049 2:201381443-201381465 TAAAAGATATTTCTTTTCAGTGG + Intronic
944695676 2:202198250-202198272 TATATGACACCTCTTTTGAGAGG - Intergenic
945265144 2:207883249-207883271 TTTCAGATAGCTCTTTTCTGTGG + Intronic
946494563 2:220182863-220182885 TTTAATTTAGCTCTTTTGAAAGG + Intergenic
1169642506 20:7769962-7769984 TAAAAGATGGGACTTTTGAGAGG - Intergenic
1177351717 21:19951702-19951724 TATAAAATACCACTTTTCAGAGG - Intergenic
1177792755 21:25737860-25737882 TATAATATATCTATTTTGTGTGG + Intronic
949238392 3:1839338-1839360 TATAACTTTGCTCCTTTGAGAGG - Intergenic
951610704 3:24490026-24490048 TATAAAATAACTATTTTTAGGGG + Intronic
953234957 3:41098036-41098058 TATGGGATAGCTATTTTGTGTGG - Intergenic
957478723 3:80761743-80761765 TATAAAATTGCTCTTTTTACAGG + Intergenic
959649812 3:108740724-108740746 TATCCGAAAGCTATTTTGAGGGG - Intergenic
960072398 3:113445978-113446000 TAAAATATAGTTCCTTTGAGTGG - Intronic
962844258 3:139261173-139261195 TATAAGATTGTCCTTTTTAGGGG + Intronic
962992236 3:140588787-140588809 TAAAAGAAAGCTTTGTTGAGAGG + Intergenic
966532265 3:180994196-180994218 TATAAGAAATCTCTTTTGGCCGG + Intergenic
969900717 4:10346696-10346718 TTGCAGATAGCTTTTTTGAGAGG + Intergenic
970831239 4:20342656-20342678 TATAAGATATCTATTTTAAGAGG - Intronic
971938513 4:33185873-33185895 TAAGAGGTAGGTCTTTTGAGAGG + Intergenic
972548291 4:40103486-40103508 TAGAAGAGAGCTAATTTGAGTGG + Intronic
972593897 4:40513560-40513582 TATAATCTAGCTTTTTTGGGTGG - Intronic
972742211 4:41898188-41898210 TTCAACATATCTCTTTTGAGGGG + Intergenic
973290223 4:48463698-48463720 TACAAGGTAGGGCTTTTGAGGGG - Intergenic
976197959 4:82551515-82551537 TATAAGATAGCTCCTTCCTGAGG - Intronic
977606151 4:98986923-98986945 TATAAGGTATCTCCTGTGAGAGG - Intergenic
978488095 4:109279046-109279068 TAAGAGGTAGGTCTTTTGAGAGG - Intronic
980381688 4:132028862-132028884 TTTAGGATAGTTTTTTTGAGTGG - Intergenic
986228388 5:5838733-5838755 GATAAAATATTTCTTTTGAGAGG + Intergenic
987159753 5:15130029-15130051 TATATGATATTTCTTTTGGGTGG + Intergenic
987231293 5:15896422-15896444 TATGAGATAGGTCGTTTTAGAGG - Intronic
989593904 5:43138023-43138045 TTTGAGATAGCTCATATGAGTGG - Intronic
990137342 5:52662296-52662318 TATTTGAAAGCTCTCTTGAGGGG + Intergenic
991453117 5:66773655-66773677 TAAAAGAAACCTCTTTTAAGAGG - Intronic
993423678 5:87734861-87734883 TATAAGAAAGTTCTTTTAATGGG + Intergenic
994612420 5:102060453-102060475 TAGAAGATAGTTCAATTGAGGGG - Intergenic
997014609 5:129918301-129918323 AATAAGAGAGTTCTTATGAGTGG + Intronic
997456818 5:134023809-134023831 TATAAGTCACCTCTTTGGAGAGG - Intergenic
998064525 5:139147231-139147253 GATTAGATACCTCTTTGGAGTGG - Intronic
998244161 5:140481916-140481938 TATAAGCAAGCTCCTTTTAGTGG + Intronic
1002777290 6:340024-340046 TAAACGATAGTTCTTTTAAGTGG - Intronic
1005819965 6:29589806-29589828 TATATGATAGGTTTTTTGGGAGG - Intronic
1005878455 6:30034234-30034256 TATAAAATAACTATATTGAGAGG - Intergenic
1007638632 6:43317370-43317392 TCTTAGATAACTCTTTTGAAAGG + Intronic
1011473663 6:87732208-87732230 TCTAAGATTGCTCTTTTGCTTGG + Intergenic
1011811460 6:91136850-91136872 TATAAGATAGCTCTAGTGCATGG + Intergenic
1013581498 6:111539259-111539281 TCTAACAAAGGTCTTTTGAGAGG + Intergenic
1014280352 6:119436211-119436233 TATAATATAGCTCTTTGTAAAGG + Intergenic
1017697551 6:157032431-157032453 TTGAAGATAGCTCTTTCTAGCGG + Intronic
1019839286 7:3423466-3423488 TATAAGATAGATTTTTTTGGGGG + Intronic
1019880566 7:3856788-3856810 TATAACATAGCTGTTTTTCGAGG - Intronic
1020058290 7:5133738-5133760 TATAAGAAAACTTTTTTGAGGGG + Intergenic
1021010289 7:15455130-15455152 GATAATATAACTCTATTGAGAGG - Intronic
1026227532 7:68455820-68455842 ACTAAGATTGCTCTATTGAGAGG + Intergenic
1027244277 7:76356132-76356154 TAAAAGAGAGCTCACTTGAGTGG + Intronic
1027957890 7:84905340-84905362 TAGGAGATAGGGCTTTTGAGAGG - Intergenic
1029032608 7:97484707-97484729 TATCAGATATGTCTTTTGTGAGG - Intergenic
1031228171 7:119068573-119068595 TATAATCTAGCTCTTGTGAGGGG - Intergenic
1033339817 7:140483227-140483249 AATAAGATACCTCTTTGGAAGGG + Intergenic
1035028039 7:155839147-155839169 TCTATGACAGCTCTTTTGTGGGG + Intergenic
1036462340 8:8964483-8964505 TTTAAGTTCTCTCTTTTGAGAGG + Intergenic
1038915898 8:32022489-32022511 TATCAGAGAGCTCTATTAAGTGG + Intronic
1039290599 8:36090406-36090428 TTTAAGATGGTTCTTTAGAGTGG - Intergenic
1039933649 8:42019194-42019216 TTTGAGATACCTCTATTGAGAGG + Intronic
1043928007 8:86059849-86059871 TTTGAGATGGCTCTTTAGAGGGG + Intronic
1044902172 8:96958374-96958396 TATAAGTTGTCTCATTTGAGAGG - Intronic
1045803717 8:106131546-106131568 TAAAAGATGGCTCTTATGAAAGG - Intergenic
1048805104 8:138233004-138233026 TATTAGATACCTCCTATGAGTGG + Intronic
1048899818 8:139026882-139026904 AAGAAGATAACTGTTTTGAGAGG - Intergenic
1049658037 8:143807427-143807449 GATCTGAGAGCTCTTTTGAGAGG + Intronic
1052181205 9:25530960-25530982 TACATTATAGCTCCTTTGAGTGG + Intergenic
1052441543 9:28502586-28502608 TATAAAATATGTCTTTTTAGAGG + Intronic
1053379148 9:37635262-37635284 TATAAAATGGCTCTGTTCAGAGG - Intronic
1057606949 9:96505545-96505567 TCTAAGAGAGCTCTTCAGAGAGG + Intronic
1187260742 X:17683006-17683028 TCTAAGTTAGCTCATTTCAGAGG + Intronic
1188436172 X:30161028-30161050 GATAAGATGGCTTTTTTCAGTGG + Intergenic
1192408700 X:70913024-70913046 TAAAAAATAACTCTTCTGAGTGG + Intergenic
1192942226 X:75924978-75925000 TTTAAGATAGCCATTTTGATTGG - Intergenic
1196323230 X:114368913-114368935 TAAAAGATAGGTCCTTTGAAAGG - Intergenic
1198667560 X:139041380-139041402 AATGAGATAGCACTCTTGAGAGG + Intronic
1199585962 X:149415935-149415957 CATAAGATAAATCTTTTGAAGGG - Intergenic
1199865265 X:151842055-151842077 TATAATTTAGCTATTATGAGTGG - Intergenic
1201281051 Y:12342324-12342346 GATTTCATAGCTCTTTTGAGAGG - Intergenic