ID: 922382806

View in Genome Browser
Species Human (GRCh38)
Location 1:225049647-225049669
Sequence ATTTTCTCCTTGAAGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922382804_922382806 11 Left 922382804 1:225049613-225049635 CCTAACTCAAGATCACACAGATT 0: 1
1: 5
2: 51
3: 323
4: 1712
Right 922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG 0: 1
1: 0
2: 5
3: 68
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922382806 Original CRISPR ATTTTCTCCTTGAAGATTTA TGG Intronic
902960573 1:19960386-19960408 ATTTTTTACTTTAAGTTTTAGGG + Intergenic
902961597 1:19967385-19967407 ATTTTCTCCTTGATTATCTTAGG + Intergenic
904204622 1:28845679-28845701 ATTTTCTTCTAGGAGTTTTATGG + Intronic
904390381 1:30181368-30181390 TTTTTCTTCTTGTTGATTTAAGG - Intergenic
904951326 1:34241824-34241846 ATTTTCTTCGAGAAGTTTTATGG + Intergenic
905084012 1:35353586-35353608 AATTTCTCATGGAAGATTTCTGG - Intronic
905593240 1:39183521-39183543 TTTCTCACCTTGAAGATTTGGGG - Intronic
907805099 1:57810924-57810946 ATTTCCTTCTGGAAGATCTAGGG + Intronic
908051164 1:60232338-60232360 TTATTTTCCTTGATGATTTAAGG + Intergenic
908213057 1:61921231-61921253 ACTGACTCCTTGAGGATTTAAGG + Intronic
908715570 1:67066502-67066524 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
908724471 1:67160465-67160487 ATTTTCTCCAGAAAGATTTAGGG - Intronic
908940154 1:69422489-69422511 ATTTATTCCTTACAGATTTAAGG + Intergenic
909137859 1:71823799-71823821 ATTTACTGCCTGCAGATTTACGG + Intronic
909325510 1:74347011-74347033 TTTTTCTACTTTAAGTTTTAGGG + Intronic
909734095 1:78934439-78934461 ATTTTCTTCTAGGAGTTTTATGG - Intronic
909769933 1:79408962-79408984 ATTTTTCCCTTGAAGAATGAAGG + Intergenic
910105326 1:83625822-83625844 GTTGGCTCTTTGAAGATTTATGG - Intergenic
910321438 1:85949385-85949407 ATTTTCAGCTTGGATATTTAGGG + Intronic
910868761 1:91812497-91812519 ATATTTTTCTTGAAGATGTAGGG + Intronic
912323234 1:108734123-108734145 ATTTTCTGCTTTGAGATTTAGGG + Intronic
912487356 1:110039672-110039694 ACTTACACCTTGAAGATTAATGG + Intronic
912591575 1:110826022-110826044 GTTTTCTTCTTGTAGTTTTAGGG - Intergenic
912609040 1:111024311-111024333 ATTTTCTTCTAGGATATTTATGG - Intergenic
912993896 1:114514275-114514297 AGTTTCTCCTGCAAGATTTCTGG - Intergenic
913019564 1:114775014-114775036 ATTTTCTACTTGAAGTATTAAGG + Intronic
913581291 1:120229636-120229658 CTTTTCTCCTTGTAGATACATGG - Intergenic
913626886 1:120668764-120668786 CTTTTCTCCTTGTAGATACATGG + Intergenic
914495296 1:148191176-148191198 ATTTTGTCCTTCAATTTTTAAGG - Intergenic
914563222 1:148841070-148841092 CTTTTCTCCTTGTAGATACATGG - Intronic
914609605 1:149289153-149289175 CTTTTCTCCTTGTAGATACATGG + Intergenic
915710095 1:157888414-157888436 CTTTTCTTCTAGAAGTTTTATGG - Intronic
915759238 1:158294042-158294064 ATTTTCTCCTTAAACATTTAAGG + Intergenic
915810798 1:158908118-158908140 ATTTTCTCCTCCCAGATTTTTGG - Intergenic
916398667 1:164421521-164421543 GTTTTTTCCTGGAAGTTTTAAGG + Intergenic
916530359 1:165650865-165650887 AATTTCTGCTTAAATATTTATGG - Intronic
916944691 1:169714508-169714530 GTTTTCTCCTAGAATTTTTATGG - Intronic
917055493 1:170977498-170977520 ATTTTGTTGTTGAAGCTTTAGGG + Intronic
917072154 1:171163634-171163656 ATTTTCTGCTAGAAGTTTTAGGG - Intergenic
917630858 1:176890075-176890097 ATTTTCTACGTGAAGCATTAAGG + Intronic
918838596 1:189503959-189503981 ATTTTCTCCTTTAAGCTCAATGG - Intergenic
919436502 1:197568845-197568867 GTTTTCTTCTTGTAGTTTTATGG - Intronic
919659852 1:200233829-200233851 ATTTTCTCTTTAAAAATTTCTGG - Intergenic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
921531520 1:216287789-216287811 TTTTTCTCCCTGAAAATCTAAGG - Intronic
921616025 1:217268792-217268814 ATTTTCTTCTGAGAGATTTAAGG + Intergenic
921631987 1:217444985-217445007 ATAATCTTCTTGAATATTTAAGG - Intronic
921836826 1:219786908-219786930 GTTTTCTCCCAGAAGCTTTATGG - Intronic
922052858 1:222010900-222010922 ATGGTATCCTTGAATATTTAGGG - Intergenic
922118684 1:222640645-222640667 AATTTTTCCTAGAAGTTTTATGG - Intronic
922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG + Intronic
923169460 1:231400313-231400335 ATTTTCTCCATGGAATTTTAAGG + Intronic
923965785 1:239137231-239137253 ATCTTTTCCTTTAAGATTTTAGG + Intergenic
924114636 1:240733138-240733160 ATGTTCTCTCTGAATATTTAAGG - Intergenic
1063845278 10:10120928-10120950 ATTTAATCCTTGAAGATCTTTGG + Intergenic
1064803004 10:19097513-19097535 TTTGTCTCCTTGAACATTTTAGG - Intronic
1065324959 10:24542700-24542722 AATTTTTCCATGAAGATGTACGG + Exonic
1066650904 10:37654279-37654301 TTTTTCTCCTTGATCTTTTATGG + Intergenic
1066666032 10:37783403-37783425 ATTTTCTTCTTAAAGTATTATGG - Intronic
1066748602 10:38629368-38629390 ATTTTCTACTAGTAGTTTTATGG - Intergenic
1066820929 10:39488269-39488291 TTTTTCTACTTTAAGTTTTAGGG - Intergenic
1066986604 10:42474231-42474253 ATTTTCTGCCTGAGGTTTTAAGG + Intergenic
1068220718 10:54042190-54042212 ATTCTCTCTTTTAAGTTTTAGGG + Intronic
1068814184 10:61291324-61291346 AATTTCTCCCTGGAGATTTGGGG + Intergenic
1068877627 10:62013821-62013843 ATTTTCTCTTTTAATTTTTATGG + Intronic
1068907142 10:62339206-62339228 ATTATCTTCTAGAAGTTTTATGG + Intergenic
1070445663 10:76498611-76498633 ATTTCTTCCTTGATGAATTAAGG + Intronic
1070485799 10:76930015-76930037 TTTTTCTCCTAGGAGTTTTACGG - Intronic
1070858140 10:79625425-79625447 ATTTTCTTCTTAAATATATAGGG + Intergenic
1071199798 10:83208166-83208188 ATTTTCTCCTTTGTGTTTTAAGG + Intergenic
1071204673 10:83260237-83260259 ATTTTCTCCTGGAATTTTGACGG + Intergenic
1071252413 10:83833882-83833904 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1071308706 10:84323516-84323538 GATTTCTCCTTGAGGATTCATGG + Intergenic
1071686911 10:87767970-87767992 ATTTACTCATTAAAGATTAAAGG - Intronic
1071956224 10:90762739-90762761 GTTTTCTTCTTGGAGTTTTATGG + Intronic
1072759499 10:98044727-98044749 ATTTTCTGCTTGAGGATATTGGG + Intergenic
1073174600 10:101545982-101546004 ATTTTTTCCTTGCAGTTCTATGG - Intronic
1073623061 10:105068729-105068751 ATTTTCTTTTTGAAAATTTGAGG + Intronic
1073725461 10:106225041-106225063 TTTTTCCCCATGAAGATTTCTGG - Intergenic
1074006382 10:109429042-109429064 ATTTTCTTCTTCAAAATTCAAGG + Intergenic
1075239273 10:120763464-120763486 CTTTTCTAGATGAAGATTTAAGG + Intergenic
1075259142 10:120947985-120948007 ATATTATACTTGAAGTTTTAGGG + Intergenic
1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG + Intergenic
1076198913 10:128542160-128542182 CTTTTTTCCTTGAACATTTAAGG - Intergenic
1078017102 11:7624302-7624324 GTTTTCTCCCTGATGACTTACGG + Intronic
1078803898 11:14676924-14676946 GTTTTCTTCTAGAAGTTTTATGG + Intronic
1079327848 11:19509746-19509768 ATTTTCTCCTTAGAGTTTTAGGG - Intronic
1079691416 11:23422686-23422708 TTTTTGTCATTGAAGATTTTGGG - Intergenic
1079720347 11:23803780-23803802 ATATTCTCATAGAATATTTAGGG - Intergenic
1079743293 11:24092128-24092150 ATTATCTCATTGATGATATAAGG + Intergenic
1079850388 11:25526216-25526238 TTTTTCTCCTTTAAGGGTTAGGG - Intergenic
1080197382 11:29628444-29628466 ATTAGCTCCTTGGAGAGTTATGG + Intergenic
1080216329 11:29845549-29845571 ATTCTCTCCTGGAAGAAGTATGG + Intergenic
1080629071 11:34055630-34055652 ATTTTCTCCTTTATGACTTTAGG - Intronic
1081099195 11:38981220-38981242 ATTTTTTTCTAGGAGATTTATGG - Intergenic
1081412879 11:42780690-42780712 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1081511554 11:43779087-43779109 ATTTTGACCTTCAAAATTTATGG + Intronic
1081832528 11:46125839-46125861 ATTTTCTTCTTGTATTTTTATGG + Intergenic
1081957495 11:47106377-47106399 TTTTTCTCCTTGAAAATTCAGGG + Intronic
1082210956 11:49500405-49500427 ATTTTGTCCTTTAAAATTTTTGG - Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1083120059 11:60503171-60503193 ATTTTCTCCTTCTAAATTTGGGG + Intronic
1084840953 11:71847107-71847129 GTTTTCTCCTAGAATTTTTATGG + Intergenic
1085500085 11:77012575-77012597 ATTTAATCCTTAAACATTTAAGG - Intronic
1085791840 11:79503263-79503285 ATTTTCTCCTTGCACTTCTATGG - Intergenic
1087505676 11:99018360-99018382 ATTTTCTGCTTGGAGAGTAAGGG - Intergenic
1087608035 11:100401120-100401142 GTTTTCTCCTAGAGGTTTTATGG + Intergenic
1087804022 11:102536300-102536322 ATTTTCTCCTAAGAGTTTTATGG + Intergenic
1088308830 11:108438591-108438613 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1088804186 11:113336484-113336506 ATTTTCTTCTAAAAGTTTTATGG + Intronic
1088855813 11:113752460-113752482 ATTTTCAAATTGAAGATTTGTGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092365306 12:7872462-7872484 TTTTTATTCATGAAGATTTACGG + Intronic
1092452984 12:8620362-8620384 ATTTTCTTCTAGTAGTTTTACGG + Intergenic
1093012405 12:14122665-14122687 TTTTTTTCCTGGAAGTTTTATGG - Intergenic
1093360069 12:18214299-18214321 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1093683312 12:22028210-22028232 ATTTTCTTCTAGAATTTTTATGG - Intergenic
1094245159 12:28282810-28282832 GTTTTCTCCTAGAATTTTTATGG + Intronic
1094251958 12:28371942-28371964 ATTTTCTTCTTCAAATTTTATGG + Intronic
1095137656 12:38625356-38625378 ATTTTGTCTTTGAAGCTTTACGG - Intergenic
1095328554 12:40928424-40928446 GTTTTCTTCTTGCTGATTTAGGG - Intronic
1095354031 12:41249913-41249935 AATTTCCCCATGAAGTTTTATGG + Intronic
1096059054 12:48681270-48681292 ATTTTGTCCTTGTAAATTTGGGG - Intronic
1096471230 12:51877494-51877516 ATCTTCTTCTTGAAGATAAATGG + Intergenic
1097318957 12:58204510-58204532 ATGATCACCTTGAAGAGTTAAGG - Intergenic
1097502265 12:60419350-60419372 ATTATCTCCATAAAGTTTTACGG + Intergenic
1097511887 12:60553225-60553247 ATTTTATCCTTCAGGATATATGG + Intergenic
1098794225 12:74867762-74867784 ATTTTATTTTTGTAGATTTAGGG + Intergenic
1098895491 12:76055681-76055703 AATTTCTCCTGGAAGAGTTAAGG + Intronic
1099251169 12:80256845-80256867 ATTGTCTCATTGAGCATTTAAGG + Intronic
1099373497 12:81866863-81866885 ATATTCTTCTTTAAGATTTTTGG + Intergenic
1099545570 12:83975790-83975812 ATTTTATTTTTGAATATTTATGG + Intergenic
1099563161 12:84204928-84204950 GTTTTCTCCTTGTATTTTTATGG + Intergenic
1099645682 12:85352488-85352510 AATTAGTCCTTGAAGTTTTATGG + Intergenic
1099823148 12:87740997-87741019 ATTTCCTGGTTGGAGATTTAAGG - Intergenic
1100127425 12:91445377-91445399 GTTTTCTTCTAGAAGATTCATGG - Intergenic
1100488103 12:95051108-95051130 ATTTTCACTTAGAAAATTTAAGG - Intronic
1100850942 12:98710222-98710244 ATTTTCTCATAGTATATTTAGGG + Intronic
1101027104 12:100620694-100620716 ATTTTCTGATTCACGATTTAGGG + Intronic
1101066407 12:101026774-101026796 ATTTTCTCCTAGAATTTTTATGG - Intronic
1101812437 12:108119644-108119666 ATTTTCTACTAGAAGATTCAAGG - Intergenic
1102657571 12:114495319-114495341 ATTTTTACCTTGGATATTTAAGG - Intergenic
1103425317 12:120829182-120829204 GTTTTCTTCTAGAAGCTTTATGG - Intronic
1103610791 12:122123075-122123097 CTCCTCTCCTTGAAGATTGACGG + Intronic
1104051546 12:125197688-125197710 ATTCCCTACTTGAACATTTAAGG - Intronic
1104587466 12:130059056-130059078 AGTTAATCCATGAAGATTTAAGG - Intergenic
1105498947 13:20954583-20954605 GTTTTCTTCTAGAAGATTTTTGG - Intergenic
1105666457 13:22563305-22563327 TTTTTTTCCTTGAATATTTTTGG - Intergenic
1106668408 13:31878103-31878125 ATTTTCTCTTGGAAGAATCATGG + Intergenic
1106888814 13:34220177-34220199 ATTATCTCCTTAAAGTTTAAAGG + Intergenic
1106978113 13:35246842-35246864 ATATTCTCTTTGGAGATCTAGGG - Intronic
1106986727 13:35361576-35361598 GTTTTCTCCTAGAAGTTTTATGG - Intronic
1107687972 13:42923172-42923194 ATTTTATCCTTGAAGATATGGGG + Intronic
1107841979 13:44467286-44467308 GTTTTCTTCTAGAATATTTATGG - Intronic
1108915974 13:55612052-55612074 TTTTTTTCCTTGAAGAGTTAGGG + Intergenic
1108990741 13:56654149-56654171 ATTTTCTCCATAAAGGTTTTAGG + Intergenic
1109018933 13:57059892-57059914 GTCTTCTCCTTGCAAATTTATGG + Intergenic
1109106840 13:58263482-58263504 ATTTTCTCCTAGACTTTTTATGG - Intergenic
1109358493 13:61265987-61266009 ATTTTATCTTTGTATATTTAAGG + Intergenic
1109570122 13:64177249-64177271 ATCTCCTCCTTGAACATTCATGG + Intergenic
1110697353 13:78506648-78506670 AATTTCCCCAAGAAGATTTACGG + Intergenic
1110908211 13:80919583-80919605 ATTTTTTCCTTGTAGAATAAGGG - Intergenic
1111056582 13:82958190-82958212 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1111183239 13:84695728-84695750 ATTTTGTCCTTTTACATTTAAGG - Intergenic
1111423846 13:88053233-88053255 TTAATCTCCTTGAAGATTCAAGG - Intergenic
1111451904 13:88429480-88429502 TTTTTCTACTTGAAAACTTAAGG + Intergenic
1111481639 13:88834992-88835014 ATTTTCTCCTAGCAATTTTATGG + Intergenic
1111830719 13:93325707-93325729 TTTTTCTTTTTGTAGATTTAAGG - Intronic
1113181762 13:107636481-107636503 ATTTTTTCCTTGAAAATAAATGG - Intronic
1113278886 13:108766828-108766850 AGTTTGTCCTTGAAGATAAAGGG + Intronic
1113418048 13:110146421-110146443 ATTTTCTTCTCAAAGTTTTATGG - Intergenic
1113499552 13:110762391-110762413 ATTTCTTCCATGATGATTTAGGG + Intergenic
1114750871 14:25203572-25203594 ATACTCTGCTTGAAGATGTAGGG + Intergenic
1114816637 14:25966622-25966644 ATTTTCTCCTTGAAGTAGGAGGG + Intergenic
1115022880 14:28704319-28704341 TTTTTTTCTTTGAAGCTTTAAGG - Intergenic
1116368995 14:44106135-44106157 GTTTTCTCCTAGGAGTTTTATGG - Intergenic
1116804367 14:49478066-49478088 ATTTTTTCCTAGAAAATTAAAGG + Intergenic
1117070456 14:52051266-52051288 AGTTTCCCTTTGAAGCTTTAGGG - Intronic
1117101358 14:52351636-52351658 CTTTCCTCTCTGAAGATTTAAGG + Intergenic
1117665637 14:58053232-58053254 ATGTTCTCCTTGAATTTTAAAGG - Intronic
1117706915 14:58479626-58479648 GTTTTCTTCTAGAAGATGTATGG + Intronic
1118411369 14:65482090-65482112 GTTCTCTCCTGGAAGTTTTATGG + Intronic
1118654860 14:67935777-67935799 ATTTGCTCCTTCAGGATCTAGGG + Intronic
1119108326 14:71945950-71945972 ATTTTCTCCTTAAACTTCTATGG + Intronic
1120597725 14:86461977-86461999 ATTGTTTCCTAGAAGATTTTGGG - Intergenic
1120727166 14:87957358-87957380 ATTTTCTTCTAGAATTTTTATGG + Intronic
1121379011 14:93444533-93444555 ATTTTCTTCTAGAAGTTTAATGG + Intronic
1121787724 14:96675064-96675086 ATTTTCTCCTCAAAGATTGCAGG + Intergenic
1121894416 14:97632679-97632701 ATTTTTTCCTTCACGATTTCGGG - Intergenic
1122376432 14:101263016-101263038 ATTTTCTTTTAGAAGCTTTATGG + Intergenic
1122764725 14:104058997-104059019 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1124504087 15:30257267-30257289 GTTTTCTCCTTGGAGTTTTATGG + Intergenic
1124739466 15:32281379-32281401 GTTTTCTCCTTGGAGTTTTATGG - Intergenic
1125233907 15:37489608-37489630 ATATTCTACTTGAAGACTGAGGG + Intergenic
1125736256 15:41928520-41928542 ATTTTCTCCTTTTTGATTTGTGG + Intronic
1126528258 15:49682622-49682644 ATTCTCTCCTTGAAGATAGAGGG - Intergenic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1129535164 15:76308122-76308144 ATTATCTTCTTGCATATTTATGG - Intronic
1129547460 15:76412004-76412026 ATTTTCTGCTAGAAGTCTTATGG + Intronic
1130458370 15:84138005-84138027 ATTTTTTCTTTAAAAATTTAAGG + Intergenic
1130806019 15:87323560-87323582 ATTTTCTTCTAGAAGTTTCATGG - Intergenic
1132916528 16:2349356-2349378 GTTTTCTTCTAGAAGTTTTACGG + Intergenic
1133066063 16:3207998-3208020 ATTTTCTTCTTTATGGTTTATGG - Intergenic
1134199512 16:12186439-12186461 ATTATCTGCTTGAGTATTTAGGG - Intronic
1135233893 16:20737623-20737645 TTTTTCTTTTTAAAGATTTAAGG - Intronic
1135717590 16:24785496-24785518 ATTTTCTCCTGGATTATTTTTGG + Intronic
1135774833 16:25248134-25248156 GTTTTCTTCTAGGAGATTTATGG - Intronic
1136734151 16:32447931-32447953 GTTTTCTTCTAGTAGATTTATGG + Intergenic
1138417261 16:56878556-56878578 ATTTTCTCCTTGGTGAAATAGGG - Intronic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1140030209 16:71330412-71330434 TTTTTCTTCTAGAAGTTTTAAGG - Intergenic
1140574858 16:76155943-76155965 ATTTTCTCCTTAAAATTTTGGGG + Intergenic
1140705610 16:77626015-77626037 ACTCTGGCCTTGAAGATTTATGG + Intergenic
1140724536 16:77800255-77800277 ATTTTCTCCTTGTTGATATCTGG + Intronic
1203018926 16_KI270728v1_random:381664-381686 GTTTTCTTCTAGTAGATTTATGG - Intergenic
1203037261 16_KI270728v1_random:654822-654844 GTTTTCTTCTAGTAGATTTATGG - Intergenic
1143761245 17:9105607-9105629 ATTTTCTCCTAAAAGATGTTTGG + Intronic
1143774725 17:9191054-9191076 ATTTTATTCTAGAACATTTAAGG - Intronic
1144815787 17:18033697-18033719 AATTTCACCTTTAAGGTTTAAGG - Intronic
1146224811 17:31056348-31056370 ACTTTTTGCTTGAAGCTTTAGGG - Intergenic
1146776897 17:35627386-35627408 ATTTCCTGCTTCAAGATTTCAGG - Exonic
1146804032 17:35850921-35850943 ATTGTCACCTGGCAGATTTATGG - Intronic
1147009423 17:37433109-37433131 ATTTTCTTCTTAAAAATATAGGG + Intronic
1148320101 17:46743456-46743478 ATTTTCTCATCGCATATTTATGG + Intronic
1150091607 17:62331279-62331301 ATTTTCTATTTCAAAATTTAAGG + Intergenic
1153422398 18:4922029-4922051 ATTCTCTTCTAGGAGATTTATGG + Intergenic
1153573765 18:6500070-6500092 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1153705391 18:7739839-7739861 GTCTTTTCCTTGAACATTTAAGG + Intronic
1154206599 18:12342644-12342666 ATTTTCTCCTAGAAGTTTGATGG + Intronic
1154468831 18:14677918-14677940 GTTGTCTTCTAGAAGATTTATGG - Intergenic
1155592505 18:27443916-27443938 AATTTCTCATTCAAGATTCAAGG - Intergenic
1155899825 18:31375138-31375160 GTTTACTCCTTGGAGATTTGTGG - Intergenic
1156129285 18:33950612-33950634 AATTTCTTCTTGAAGAGCTAAGG + Intronic
1156213399 18:34972431-34972453 ATTCTCTCCTTGAGGAGTGAAGG - Intergenic
1156310836 18:35920291-35920313 ATTTTCTTCTACAAGTTTTATGG - Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1156746861 18:40402875-40402897 ACATTCTCCTTGAAAATTGAAGG + Intergenic
1157827679 18:50826982-50827004 ATTTTCTCATTGAGAATTTTTGG + Intergenic
1157955629 18:52094462-52094484 ATTTTCTTCTAGGGGATTTATGG + Intergenic
1158689066 18:59644056-59644078 ATTTTTTCCATGAGGGTTTAAGG + Intronic
1158921383 18:62195452-62195474 TTTTTCTGCTTGAAGCATTAGGG + Intronic
1159083210 18:63758917-63758939 AATTTCTTCTTAAACATTTAAGG - Intronic
1159112043 18:64070549-64070571 GTTCTCTTCTGGAAGATTTAAGG + Intergenic
1159352737 18:67296579-67296601 GTTTTCTTCCTGAAGATTTATGG + Intergenic
1159398642 18:67900298-67900320 ATTTTCTCCTAGGAGTTTTACGG - Intergenic
1159441839 18:68490405-68490427 ATTTTCTCTTTTAAAATTCATGG - Intergenic
1159520889 18:69521621-69521643 GTTTTCTACTAGAAGAATTAAGG - Intronic
1159651024 18:70979063-70979085 ACTTTCTCTTTGAATATTTTTGG - Intergenic
1159689691 18:71470936-71470958 ATTATCTCTTTTGAGATTTAGGG + Intergenic
1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG + Intergenic
1160393619 18:78556418-78556440 ACTTTCTCCTTAAATATTGATGG - Intergenic
1161607280 19:5222193-5222215 ATTTTCACCTTGAAGTTCTTGGG + Exonic
1163135113 19:15304911-15304933 ATTTTCTTCTGGAAGTTGTAAGG - Intronic
1164948267 19:32314426-32314448 ATTTTTTGATTGAAGATTGAAGG - Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1165125027 19:33588312-33588334 TTTTTCTACTTGAACACTTAGGG - Intergenic
1166515910 19:43446811-43446833 ATTTTGTCTTTGAAGCTTGATGG + Intergenic
1168577181 19:57522283-57522305 ATTATCTCCTAGAAGTTGTATGG + Intergenic
1168585944 19:57591983-57592005 ATTTTTTCCTAGGAGATTTTAGG - Exonic
925206232 2:2008783-2008805 ATTTTCTTCTTGGAGTTTTATGG + Intronic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
926995856 2:18735193-18735215 ATTTTCTTCTAGGAGTTTTATGG - Intergenic
927049917 2:19317239-19317261 GTTTTCTCCTAGAATTTTTATGG + Intergenic
929006582 2:37399478-37399500 ATTTTCTTCTTAGAGTTTTATGG + Intergenic
929323417 2:40575430-40575452 ATTTCTTCCTTAAACATTTAAGG + Intronic
929348711 2:40920749-40920771 ATTTTCAGCTTGGTGATTTAGGG - Intergenic
929407083 2:41655097-41655119 TTTTTCTCCTTGTAGATTTCAGG + Intergenic
929927452 2:46226803-46226825 TTTTTCTCTTTGAATATTAAGGG - Intergenic
930261503 2:49152442-49152464 ATATACTCCCTGAAGCTTTAGGG + Intronic
930804174 2:55473433-55473455 ATTTTCTACTTAAAAAATTATGG - Intergenic
930946490 2:57083286-57083308 TTTTTTTCCTTAAACATTTAAGG - Intergenic
931175958 2:59855648-59855670 ATTTTCTCATTTAAGAGTTTGGG - Intergenic
931371348 2:61666312-61666334 TTTGTCTCCTGGAGGATTTATGG - Intergenic
931746632 2:65296743-65296765 CTTTTCTCCTTGAGCTTTTACGG - Intergenic
932528947 2:72505191-72505213 ATTATCTTCTAAAAGATTTATGG + Intronic
932530312 2:72523476-72523498 ATTCTCTTCATTAAGATTTACGG + Intronic
932744701 2:74324118-74324140 ATTGTATCCTTGAAAATTAATGG + Intronic
933134063 2:78709733-78709755 ATTTTTTCCATCAAGTTTTATGG - Intergenic
933239766 2:79907152-79907174 ATGTTCTGCTTTAAGATTTCAGG - Intronic
933848220 2:86343511-86343533 ATTTTCTCCTTCAAGTTGAAAGG + Intergenic
933867818 2:86538780-86538802 AGCTTCTCATGGAAGATTTATGG - Intronic
933910144 2:86933275-86933297 ATTTTCTCATAGAAGATTCATGG + Intronic
934022584 2:87970134-87970156 ATTTTCTCATAGAAGATTCATGG - Intergenic
935119649 2:100172531-100172553 GTTTTCTTCTGGAAGTTTTATGG - Intergenic
936395800 2:112128204-112128226 GTTTTCTTCTTAGAGATTTATGG - Intergenic
936413697 2:112284876-112284898 ATTTTCTCATAGAAGATTCATGG + Intronic
936414858 2:112297281-112297303 ATCATATCATTGAAGATTTATGG + Intronic
937116980 2:119413953-119413975 ATTTACTCTTTGTTGATTTAAGG + Intergenic
937491830 2:122377539-122377561 ATTTACTTCATGAAGATTCAAGG + Intergenic
937575922 2:123421975-123421997 ATTTTCTCCTTTAACATGAATGG + Intergenic
937850994 2:126635798-126635820 ACTTTCACCTTGCAGATTTATGG - Intergenic
937954438 2:127413402-127413424 GTTTTCTTCTAGAAGCTTTATGG - Intergenic
937959975 2:127450284-127450306 ATTTTCTCCTAGAAGTGTTACGG + Intronic
938620009 2:133040935-133040957 ATTTTCTCCTGGATAATTTCTGG + Intronic
939114252 2:138042297-138042319 ACTTTCTCATTTAAAATTTAGGG + Intergenic
939152731 2:138492745-138492767 ATTTTCTCCTCATAGATTTGTGG + Intergenic
939659591 2:144871608-144871630 ATTTTCTCAGTGGAGATTAATGG - Intergenic
939682056 2:145148705-145148727 ATTTTCTTTTAGAAGTTTTATGG + Intergenic
939835723 2:147126745-147126767 ATTGTCTCCTAGAATTTTTATGG + Intergenic
940320697 2:152373327-152373349 ATTTTCTCCATGAACAGTTGGGG + Intronic
940330309 2:152466939-152466961 ATTTTGTCCCTGAAGATTTGAGG + Intronic
940570891 2:155431541-155431563 ATTTTATACTTGAAGATGAAAGG + Intergenic
941122182 2:161543268-161543290 ATTTTATCATTAAAGATGTATGG - Intronic
941399715 2:165015529-165015551 ATTTTAACCTTGAATACTTATGG + Intergenic
941486975 2:166094188-166094210 GTTTTCTCATTTAATATTTAAGG - Intronic
941515544 2:166471568-166471590 ATTTTCTATTTGTAGATTTTGGG - Intronic
941820201 2:169837063-169837085 GTTTTCTACTGAAAGATTTAAGG + Intronic
941828512 2:169926823-169926845 TATTTCTTCTTGTAGATTTAAGG + Exonic
942007148 2:171715905-171715927 ATTTTCTCTTTTATGATATAGGG + Intronic
942704849 2:178759338-178759360 ATTTCCTTCTTGAAGATGAAAGG - Intronic
942856333 2:180554032-180554054 GTTTTATCCTAGAAGTTTTATGG - Intergenic
943189205 2:184654255-184654277 ATTTTCTGCTTGGAGGTTTTTGG + Intronic
943346499 2:186744382-186744404 ATTTTCTGGTTGAATATTTTAGG - Intronic
943529494 2:189061614-189061636 ATTTTCTCCTTCACAACTTAGGG - Exonic
943685618 2:190814698-190814720 ATTTTCTCCTTCAGAATTCATGG + Intergenic
944150389 2:196552357-196552379 GTTTTCTCCTGGAAGCTTTCTGG + Intronic
944643990 2:201759994-201760016 ATTTTCATTTTGAAGATTTGTGG - Intronic
945055884 2:205868690-205868712 ATTTTCTCCAAGAAAACTTAAGG - Intergenic
945326308 2:208486561-208486583 ATTTCCTCCTTTAAGATGAAAGG - Intronic
945847908 2:214969261-214969283 TTTTTCTCCCTGAATATTTGAGG + Intronic
945888831 2:215406887-215406909 ATTTTCCCCTAGAAGCTTAAGGG - Intronic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946208975 2:218131859-218131881 AGTTTCTCTTTTAAGAGTTAGGG - Intronic
946666944 2:222060384-222060406 CTCTTATCCTTGAAGGTTTATGG - Intergenic
946992125 2:225345434-225345456 AGTTTCTTCTAGCAGATTTATGG + Intergenic
947429832 2:230017558-230017580 GTTTTCGCCTAGAAGTTTTATGG - Intergenic
947908733 2:233786830-233786852 ATTTTCTCCTTAACTAGTTAAGG + Intronic
1169185058 20:3608311-3608333 ATTTTCTTCTAGTAGTTTTATGG + Intronic
1170406165 20:16039850-16039872 ATCTTGTCCTTGAAGAGTTGAGG + Intronic
1170704345 20:18731864-18731886 CTTTTCTCCTTGAAGCCTTGGGG + Intronic
1170822397 20:19765680-19765702 TTTTTCTCCTTGATAATTTAGGG + Intergenic
1171016094 20:21543319-21543341 ATTTTCTACTTGATGTTGTAGGG + Intergenic
1171076864 20:22136264-22136286 ATTTTCCGCCTGAAGTTTTATGG - Intergenic
1171910915 20:30951648-30951670 TTTTTATGCTTTAAGATTTAAGG - Intergenic
1173036034 20:39411694-39411716 ATTATTTCCTTTAAGATTTTTGG + Intergenic
1174566267 20:51466626-51466648 ATTTTCTTCTGGAAGCTTTTCGG - Intronic
1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG + Intergenic
1174736400 20:52969788-52969810 GTTTTCTTCTAGAATATTTATGG - Intergenic
1174953446 20:55067858-55067880 TTTTTTTTCTTAAAGATTTAAGG - Intergenic
1175587405 20:60153194-60153216 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1175922111 20:62455097-62455119 ATTTTCTAGTGAAAGATTTAAGG - Intergenic
1175984431 20:62757178-62757200 GTTTTCTCCTAGGAGTTTTATGG + Intronic
1176277862 20:64283780-64283802 ATCTTCAACTTGAAGATTTGAGG + Intronic
1176805688 21:13479743-13479765 GTTGTCTTCTAGAAGATTTATGG + Intergenic
1177200432 21:17948284-17948306 TTTTTATCTTTGTAGATTTAGGG - Intronic
1177351484 21:19947482-19947504 ATTTTGGCTTTGAAGAATTAAGG - Intergenic
1177413767 21:20768214-20768236 TTTTTTTCCTTGAAAATTGAAGG - Intergenic
1177464346 21:21456637-21456659 ATTTTCTTCTAGTAGATTTATGG - Intronic
1177694382 21:24553396-24553418 ATGTTCTCTTTGATGATTTCAGG + Intergenic
1177766078 21:25458991-25459013 ATTTTCTCCTAAAATTTTTAAGG - Intergenic
1177782787 21:25639044-25639066 TTTTGCTCCTTGGAGATTTGAGG - Intergenic
1178538773 21:33431870-33431892 TTTTTCTCCTTTAACATTTTGGG - Intronic
1178574845 21:33777009-33777031 ATTTTCTTCTAGAAGTTTTTGGG + Intronic
1178575100 21:33780159-33780181 ATATTCTCCTGGAAAATTTAGGG + Intronic
1179180554 21:39041248-39041270 ATTTTGCCCTTAAAAATTTAGGG + Intergenic
1179644044 21:42764730-42764752 ATTTTGTCATGGAAGATTTCAGG + Intronic
1179953093 21:44722777-44722799 AGTTTCTCTTTGAAGATTCTGGG + Intergenic
1181681302 22:24497573-24497595 CTTTACTCCTTGAAGTTTGAAGG + Intronic
1182418554 22:30237040-30237062 AATTTCTCCCTGGAGACTTATGG - Intergenic
1184162634 22:42706385-42706407 TTTTTCTCCTTCAAGATTAGTGG - Intronic
1184196372 22:42931883-42931905 ATTTTAGCTTTGAAAATTTAGGG - Intronic
1184625505 22:45724765-45724787 GTTTTCTCCTAGAATTTTTATGG + Intronic
949104675 3:189460-189482 ATTTTATCATTGAATATCTATGG + Intergenic
949144178 3:675522-675544 ATTAACTCCTTCAATATTTAGGG + Intergenic
949237228 3:1823916-1823938 ATTTTATTCCAGAAGATTTAAGG - Intergenic
949587985 3:5461834-5461856 ATTTTCTTCTAGAAATTTTATGG - Intergenic
949595236 3:5537449-5537471 ATTTACTCCAAGAAAATTTAAGG - Intergenic
949688470 3:6606551-6606573 ATTGTTTCATTGAACATTTAGGG + Intergenic
951091693 3:18580968-18580990 ATTTTCTTCTAGAGGTTTTATGG - Intergenic
951160244 3:19410507-19410529 ATTTTCTCCTGCTAGCTTTAAGG - Intronic
952075455 3:29691280-29691302 ATTTTCTTCTTGACGCTTTGTGG - Intronic
952787060 3:37165919-37165941 ATTTTCTCCTACGAGTTTTATGG - Intronic
953014467 3:39059867-39059889 ATTTTGTCTTTGATTATTTATGG + Intronic
953104839 3:39867214-39867236 GTTTTCTCCTGGGAGTTTTATGG - Intronic
953128483 3:40114047-40114069 ATTTTTTCCTTTAAGTTTTGTGG - Intronic
953736946 3:45503163-45503185 ATTTTCTGCTTGAGGTTTTTAGG + Intronic
953892586 3:46764632-46764654 GTTTTCTCCTTGAAGCTGTAAGG - Intronic
954944300 3:54405603-54405625 ATTTTCTTCTAGCAGTTTTATGG - Intronic
956350692 3:68332301-68332323 ATTTTCTCCTAGGAGTTTTATGG - Intronic
956635649 3:71361962-71361984 ACTTTGTCCTTGACGATATATGG - Intronic
956762084 3:72452492-72452514 ATTTTATCCGTGTAGTTTTAAGG + Intergenic
956990821 3:74762154-74762176 ATTTTATTCCAGAAGATTTATGG - Intergenic
957323500 3:78662624-78662646 ATTTTCTCATGGAAGGTATATGG + Intronic
957373971 3:79333254-79333276 ATTTTCTTCTTGATTATTTTTGG + Intronic
957597898 3:82290980-82291002 ATTTTCTTCTTGTAGCTTTGGGG - Intergenic
957668593 3:83269983-83270005 ATTTTCTTCTAGGATATTTATGG + Intergenic
957852708 3:85830622-85830644 ATTTTCTTCTAGGAGCTTTATGG + Intronic
957856315 3:85883276-85883298 ATTTTCTCTTTCCAGCTTTAAGG + Exonic
958483339 3:94673471-94673493 CTTTTCTCCTTGAGAATTTTTGG + Intergenic
958484629 3:94688723-94688745 ATTTTCTTCTAGTAGATATATGG - Intergenic
958768607 3:98400011-98400033 ATTTTCTCCTGAATGATTTTTGG + Intergenic
958850603 3:99320494-99320516 ATTTTCAACTTGATGGTTTATGG - Intergenic
958992058 3:100857854-100857876 ATTTTCTTCTAGGAGATTCAAGG - Intronic
959102849 3:102033099-102033121 ATTTTCACCAAGAACATTTAAGG - Intergenic
959125504 3:102285747-102285769 GTTTTCTCCTGGAATCTTTATGG + Intronic
959179174 3:102956576-102956598 ATTTTGTCCTTGAAGTTAAATGG + Intergenic
959421728 3:106136429-106136451 CTTTTTTCCTGGAAGATTTTAGG - Intergenic
960057876 3:113288617-113288639 TTTTTCTCCTTGATGATCTAAGG + Exonic
960441382 3:117693172-117693194 ATTATTTCCCTGAAGATTGAAGG + Intergenic
961337623 3:126191748-126191770 ACTTTCTCCTTGAAAACTGAAGG + Intronic
962050570 3:131810092-131810114 ATTTTCTTTTGGAAGCTTTATGG - Intronic
962700586 3:137995707-137995729 ATTTTTACCTTGAAGATGAAAGG - Intergenic
963126886 3:141824636-141824658 TTTTTCCCTTTTAAGATTTATGG - Intergenic
963227047 3:142872904-142872926 ATTTTCCCCCAAAAGATTTATGG + Intronic
963375013 3:144453496-144453518 TTTTTCTCCTTACTGATTTAAGG - Intergenic
963465752 3:145679301-145679323 ATTTTCTCTTAGAACATTGAAGG - Intergenic
963617745 3:147563928-147563950 ATTATCTCCTGGAAACTTTATGG - Intergenic
964177609 3:153843520-153843542 ATTATCTGCTTGACTATTTAAGG - Intergenic
964428779 3:156581921-156581943 ACTTTCTCCTTAGAGATTAAGGG + Intergenic
964507797 3:157418337-157418359 ATTTTGTCATTGAAGATTGATGG + Intronic
965937455 3:174132084-174132106 ATTGTCTCCTTGTATATTCAAGG - Intronic
966064616 3:175803807-175803829 ATTTTCTCCTGGAATGCTTATGG - Exonic
966954707 3:184863734-184863756 ATTTCCTACTTAAAGATTTGTGG - Intronic
967150880 3:186649335-186649357 TTTTTCTTTTTGTAGATTTAGGG + Intronic
969782053 4:9413134-9413156 GTTTTCTCCTAGAATTTTTATGG + Intergenic
970168091 4:13261334-13261356 ATTTTCTCCTTAAATGATTAAGG - Intergenic
970695824 4:18675905-18675927 CTTTCCTCATTGAAGGTTTATGG + Intergenic
971184975 4:24366281-24366303 CTTTTCTCATTAAAGATTTAAGG - Intergenic
971793158 4:31195324-31195346 TTTTTCTCAGTGAAAATTTAAGG + Intergenic
971810462 4:31418879-31418901 ATTTAAGACTTGAAGATTTATGG + Intergenic
972443885 4:39124703-39124725 ATTTTCTTCTCAAAGTTTTATGG - Intronic
973766681 4:54169253-54169275 ATTTTTTCCCTCAAGTTTTATGG + Intronic
973786780 4:54339838-54339860 ATATTTTCCTTGAAGAATTGTGG - Intergenic
974144067 4:57924207-57924229 TTTTTATACTTTAAGATTTAAGG - Intergenic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
974190296 4:58495287-58495309 AGTTTCTCCTTGGAAATTGAGGG - Intergenic
974306659 4:60151514-60151536 GTTTTCTTCTAGAATATTTATGG + Intergenic
974440631 4:61911807-61911829 ATTTTCTCCTTCAACAATCAAGG + Intronic
974962647 4:68722798-68722820 TTTTTATTCTTGAAGTTTTAGGG - Intergenic
975105121 4:70559168-70559190 ATTTTCTCCTTTAAACTTTCTGG + Intergenic
975429535 4:74272420-74272442 AATTTCTCCTTGTGAATTTAAGG + Intronic
975548750 4:75588291-75588313 ATTTGTTCCTTGAATATTAATGG - Intronic
975738088 4:77401313-77401335 ATGTTCTCCTTGAGTATGTAGGG + Intronic
975797338 4:78021588-78021610 ATTTTCTCGTTGAAGAAATAGGG + Intergenic
975906384 4:79217859-79217881 CTTCTCTCTTTTAAGATTTAGGG - Intergenic
976252565 4:83067777-83067799 ACTTTCTTCTTGAGGCTTTAAGG + Intronic
977010807 4:91630122-91630144 CTTTTCTCCTTTTAGAATTAAGG - Intergenic
977398877 4:96506842-96506864 ATTTTCTTCTTGAATTTTTAGGG + Intergenic
977560281 4:98525940-98525962 ATTTTCTCATTGTAGATGAAAGG + Intronic
977813917 4:101391321-101391343 ATTTTCTCCTAGAATTTGTATGG - Intergenic
978076786 4:104540943-104540965 ATTTTCTTCTAGAGTATTTATGG + Intergenic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978704384 4:111689261-111689283 CCTTTATCCTTGAAGTTTTATGG - Intergenic
979249333 4:118548218-118548240 ACTTTCACCTAGGAGATTTAGGG + Intergenic
979801085 4:124909638-124909660 CTTTTATCCTTGGAGCTTTATGG + Intergenic
979950001 4:126880332-126880354 ATTTGCTCCTTCAACATTTCGGG + Intergenic
980073617 4:128269321-128269343 TTTTTCTGCATGAATATTTAGGG + Exonic
980504734 4:133702303-133702325 TTTTTTTCATTGAAGATTTATGG - Intergenic
980550792 4:134331617-134331639 TTTTTTTCTTTGAAGATTAAAGG + Intergenic
981812964 4:148796183-148796205 ATTTTCTCAGTGAAAATTAAGGG + Intergenic
982798331 4:159671887-159671909 AGTTTCTCCTTCAAGATGAAGGG - Intergenic
982807553 4:159785525-159785547 ATTTTCTCCTAGGAGTTTTATGG - Intergenic
983085929 4:163444372-163444394 GTTTTCTTCTAGAAGATGTATGG - Intergenic
983381132 4:166994947-166994969 ATTTTCTTTTTGAAAATATAGGG + Intronic
984207155 4:176799005-176799027 AAATTCTCCTTGAGCATTTAAGG - Intergenic
985218316 4:187676135-187676157 TTTTTATACTTGAAGTTTTAGGG + Intergenic
986205208 5:5618027-5618049 ATTTTGTTCTAGAAGCTTTATGG + Intergenic
987001615 5:13665867-13665889 ATTTTCTACTTGGATATGTAAGG - Intergenic
987240107 5:15988055-15988077 ATTTTCTTCTAGTAGCTTTATGG + Intergenic
987240939 5:15998500-15998522 TTTATCTCATTGAAGATTTGGGG + Intergenic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
987972817 5:24971945-24971967 ATTTTCTCCTTCTACATTCAAGG - Intergenic
988276947 5:29092506-29092528 GTTTTCTTCTAGAAGCTTTAAGG + Intergenic
988882132 5:35515271-35515293 ATATTTACCTTGAAGATTTAAGG - Intergenic
988931474 5:36039602-36039624 TTCATCTCCTTGAAGATTTCCGG + Exonic
988954105 5:36296602-36296624 ATCTTGACCTTGAAGATTCACGG + Intronic
989097036 5:37791274-37791296 ATTTTCTAGTTTAACATTTAGGG - Intergenic
990104891 5:52246391-52246413 ATTTTATACTTTAAGTTTTAGGG - Intergenic
990166722 5:53002829-53002851 ATTTACTTCTTGAAGTTTGATGG + Intronic
991726826 5:69543814-69543836 ATTTCTTCTTTCAAGATTTATGG - Intronic
991868131 5:71084060-71084082 ATTTCTTCTTTCAAGATTTATGG + Intergenic
992115361 5:73534064-73534086 ATTTTTTCAGTGAACATTTAGGG + Intergenic
992665110 5:79000746-79000768 ATTTTCTCATTAAATATTTTGGG + Intronic
993009446 5:82463517-82463539 ATTTTCTTCTAGAATACTTATGG - Intergenic
993372109 5:87105605-87105627 ATTTTCTCCTTACAAATGTATGG + Intergenic
994003716 5:94812818-94812840 ATTTTCTCCTAGAGGTTTTATGG - Intronic
994150310 5:96440211-96440233 ATTTTCCCCTTATAGAGTTAAGG - Intergenic
994176847 5:96720265-96720287 GCTTTCTCTTTGAAGATCTATGG + Intronic
994302904 5:98167177-98167199 ATTTTCTCTTTCAAAAATTATGG - Intergenic
994337233 5:98581645-98581667 CTTTTCTCTTTTAAGATTTTTGG - Intergenic
995660173 5:114473177-114473199 ATATTCTCTTTGAAGATATATGG - Intronic
995908865 5:117161395-117161417 CTTTTCTCCTTCCAGTTTTACGG - Intergenic
995953062 5:117740758-117740780 AGTTTCTCCTTGAATAGCTAAGG - Intergenic
996078337 5:119225068-119225090 ATTTTATCTTTGAACATTTCTGG + Intronic
996338376 5:122409702-122409724 ATTTTATCTTTGTAGGTTTAGGG - Intronic
996833410 5:127764904-127764926 ATTTTCTCCCTGAAGCTCCAGGG - Intergenic
996924678 5:128810545-128810567 TTTTTTTCCTTTAATATTTATGG - Intronic
997722024 5:136086479-136086501 ATTTTCTCCTAGAAGTTGTATGG - Intergenic
998297474 5:140985518-140985540 ATCTTCACCGTGAAGCTTTAAGG - Intronic
998378791 5:141709306-141709328 ATTTTATCCTTGACGTTTTGAGG - Intergenic
998620543 5:143789675-143789697 ATTATTTCCTTGAATATTCAGGG - Intergenic
998912219 5:146972298-146972320 ATGTTCACCTTGTGGATTTAAGG + Intronic
999731625 5:154479817-154479839 ATTCTCTCCTTGAACAGATATGG + Intergenic
1001185357 5:169566314-169566336 TTTTTCTCCTTGACAATTCAGGG - Intergenic
1001263856 5:170257429-170257451 CTTCTCTCCTTGAATATTAAGGG + Intronic
1001872997 5:175173613-175173635 TTTTTGTCCTTAAAGATGTATGG + Intergenic
1002788579 6:422613-422635 ATTTGCTTGTTGGAGATTTATGG - Intergenic
1004762220 6:18679894-18679916 ATTTTCTTGTAGAAGTTTTATGG - Intergenic
1005223033 6:23609855-23609877 ATTTTTTCTTTGAAGATTCATGG + Intergenic
1005705550 6:28448357-28448379 GATTTGTCCTTTAAGATTTAGGG + Intergenic
1006197874 6:32258201-32258223 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1007165612 6:39826871-39826893 ATTTTCTCTTTGAAGCTTGAAGG - Intronic
1007986341 6:46210878-46210900 ATTTTCTCCTGGAAGCTTTTAGG - Intergenic
1008306384 6:49906582-49906604 CATTTCTCCTTTTAGATTTAGGG - Intergenic
1008700224 6:54090242-54090264 ATTTTCTGCTGGAAGAGTCATGG - Intronic
1009249232 6:61277259-61277281 CTTTTTTCCTTGAATATATATGG - Intergenic
1009319473 6:62269137-62269159 ATTTTCTTCTAGAAGCTTTATGG - Intronic
1009485800 6:64220161-64220183 ATTTTTTACTTTAAGTTTTAGGG - Intronic
1009678394 6:66857613-66857635 AGTTTCTCCTTGAGGAATGAAGG - Intergenic
1009705372 6:67243169-67243191 ATTTTCTCCTGATACATTTATGG - Intergenic
1010112989 6:72264029-72264051 ATTTTTTAATTGAAGTTTTAAGG + Intronic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1010656645 6:78519068-78519090 AATGTCTCCTTGAAAATTTCAGG - Intergenic
1011443647 6:87413652-87413674 TTTTTCTCCTTGAGGACTTCAGG - Intronic
1011592094 6:88979786-88979808 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1012034923 6:94123000-94123022 ATTTTTTCTTTGAAGATTTATGG + Intergenic
1012090992 6:94896677-94896699 TTTTTATCCTTAAAGAATTAGGG + Intergenic
1012107637 6:95184397-95184419 ATTTTCTCCTTAGAATTTTAAGG + Intergenic
1012606644 6:101166387-101166409 CTTCTCTCATTGAAGATTTCAGG - Intergenic
1012859012 6:104536646-104536668 TTTTTCTGCTTTAAGTTTTAGGG + Intergenic
1013024634 6:106258960-106258982 ATGTACTCATTGAAGAATTATGG - Intronic
1013347166 6:109272089-109272111 ATTTTCTTCTAAGAGATTTATGG + Intergenic
1014257908 6:119182458-119182480 GTTTTCTCCTAGGAGTTTTATGG + Intronic
1014279297 6:119422973-119422995 ATTTTCTTCTAGAATTTTTATGG - Intergenic
1014756328 6:125305211-125305233 ATTTCCTCCTGGAAGCTCTAGGG - Intergenic
1014934346 6:127368940-127368962 ATTTTTTGCTTGTTGATTTAAGG + Intergenic
1015022771 6:128496281-128496303 CTTTTCTGCCTTAAGATTTAGGG - Intronic
1015042118 6:128733514-128733536 ATCTCATCATTGAAGATTTAAGG - Intergenic
1015930612 6:138355631-138355653 ATTTTATACTTTAAGTTTTAGGG + Intergenic
1016203312 6:141440476-141440498 CTTTTCTTCTAGAAGTTTTAAGG + Intergenic
1016260587 6:142165091-142165113 ATATTCTCCTTTATGAATTAAGG - Intronic
1017349540 6:153423503-153423525 ATTTTCTTCTAGAAACTTTATGG + Intergenic
1017812659 6:157995235-157995257 ATCTTCTCCTTTTAGATTTCAGG + Intronic
1018157778 6:161004781-161004803 ATTATGTCCTTGATTATTTAAGG - Intronic
1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG + Intergenic
1018865126 6:167740543-167740565 ATTTTCTTCTCGAAGCATTAGGG + Intergenic
1020379746 7:7530168-7530190 ATTTTGTAGTTGAAAATTTAAGG - Intronic
1020820374 7:12959592-12959614 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1020871469 7:13634998-13635020 TTTTTCTTCTAGAAGTTTTATGG - Intergenic
1021143735 7:17059526-17059548 ATTTTGTCCTTGAATATAAAAGG - Intergenic
1021160417 7:17265614-17265636 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1021744695 7:23727226-23727248 CTTTTCTCTTTGTAGATTTATGG + Exonic
1022303518 7:29124500-29124522 ATTTTCAACTTTAATATTTAAGG - Intronic
1022783531 7:33611876-33611898 ATTTTATCCTTTAATATTAAAGG - Intergenic
1022809479 7:33854978-33855000 ATTTTCTACTTGAAGAATCCAGG - Intergenic
1023281785 7:38578113-38578135 ATTTTCTCCTGGAAAAGTTTGGG - Intronic
1023662390 7:42483212-42483234 ATTTGCTGCTTGAGGATTTCAGG - Intergenic
1024379387 7:48677518-48677540 GTTTTCTTCTGGAATATTTAGGG + Intergenic
1024489757 7:49966985-49967007 ATTTTCTGCTTGTAGAATTTTGG - Intronic
1024893530 7:54229984-54230006 AACTTCTCCTTGATGATTTTTGG + Intergenic
1024900388 7:54312403-54312425 AACTTCTCCTTGATGATTTTTGG - Intergenic
1026623765 7:71974577-71974599 ATTCTGTCCTTGAAGATTCTGGG + Intronic
1026636248 7:72084355-72084377 ATTTTCTGCTGGAAGATTTATGG - Intronic
1026649184 7:72200011-72200033 ATTTCTTCTTTGAAGATTGAAGG - Intronic
1026691129 7:72550866-72550888 ATTTTCTCTTTGAAGCAATACGG - Intergenic
1027005534 7:74689662-74689684 TTTTTCTTCTTGAATAGTTATGG + Intronic
1027411411 7:77923422-77923444 ATTTTTTCCTTGATGGTTTTGGG + Intronic
1027639966 7:80720747-80720769 ATTTTCTCCTTCCAAATTTAGGG + Intergenic
1027839678 7:83292914-83292936 ATTTTATACTTTAAGTTTTACGG - Intergenic
1027871903 7:83717731-83717753 TTTTTAAACTTGAAGATTTATGG + Intergenic
1030378687 7:108785672-108785694 TATGTCTCCTGGAAGATTTAAGG + Intergenic
1032928190 7:136633999-136634021 TATTTCTCCTTGAAGTTTAAAGG + Intergenic
1033433832 7:141314295-141314317 TTTTTCTCCTGCAAGATTTTGGG + Intronic
1033509659 7:142046876-142046898 ATTTTTTCCTATAATATTTAAGG + Intronic
1034004487 7:147454558-147454580 ATTGTATCCTTGAAGTTATAGGG - Intronic
1036468834 8:9031109-9031131 TTTTTCTCCTTGTAGCTTTCAGG + Exonic
1036689193 8:10931738-10931760 AGTTTCTTCTTAAAGTTTTATGG - Intronic
1036837085 8:12081300-12081322 GTTTTCTCCTAGAATCTTTATGG - Intergenic
1036858879 8:12327545-12327567 GTTTTCTCCTAGAATCTTTATGG - Intergenic
1037454592 8:19050816-19050838 TTTTTATACTTTAAGATTTAGGG - Intronic
1037459715 8:19096828-19096850 ACTTCCTTCTTGAAGATTTGTGG - Intergenic
1037728335 8:21502750-21502772 ATTTTCACCTGGGAAATTTAAGG - Intergenic
1038077665 8:24095288-24095310 ATTTTCTCCTTTATGCTTTCTGG - Intergenic
1038332176 8:26617566-26617588 GTCTTCTCTTTGAAGTTTTAGGG + Intronic
1039313920 8:36351037-36351059 ATGAGCTCCTTGAAGTTTTAGGG + Intergenic
1039563144 8:38529076-38529098 ATCTTCTGCTTTCAGATTTAAGG + Intergenic
1040442828 8:47462492-47462514 AGTTTCTTCTTGGAGATTTGGGG - Intronic
1041579717 8:59445171-59445193 TTTTTCTCCTTCATGCTTTAAGG + Intergenic
1041762090 8:61378306-61378328 TTTTTCTCCCTGAAAATGTATGG + Intronic
1041790592 8:61692585-61692607 ATTTTCACCTGGAAGGTTTTTGG - Intronic
1041978320 8:63825427-63825449 AATATCTGCTTGGAGATTTATGG - Intergenic
1043074424 8:75678490-75678512 CTTTTCTCCATAATGATTTAGGG - Intergenic
1043292982 8:78627271-78627293 GTTTTCTTCTAGAAGTTTTAGGG - Intergenic
1043387686 8:79764796-79764818 TTTTTCTCCTTGTATAGTTATGG - Exonic
1043718555 8:83514146-83514168 ACTTTCTTTGTGAAGATTTATGG - Intergenic
1043751371 8:83940116-83940138 GTTTTCTTCTAGGAGATTTATGG + Intergenic
1044327996 8:90882328-90882350 CTGTTTTCCTTGAAGTTTTAGGG - Intronic
1044797042 8:95912200-95912222 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1044813466 8:96087196-96087218 ATTTTCTCTTTGAAGAATGTAGG - Intergenic
1046196615 8:110872117-110872139 ATTTTCTGCCTAAAGTTTTAAGG + Intergenic
1046365844 8:113230294-113230316 TTTTTTTCCTTGTAGAATTATGG + Intronic
1046444194 8:114294782-114294804 AACTTCTCTTTGAAGATTTAGGG - Intergenic
1048409344 8:134155788-134155810 ATTTTCTCTTTGAAGGCTTTTGG + Intergenic
1048704052 8:137130556-137130578 GTTTTCTCCTGGAATGTTTAGGG - Intergenic
1051113582 9:13668190-13668212 ATTTTCTCCCTGAAGGTTTGGGG - Intergenic
1051948838 9:22605733-22605755 AATTTCTTTTTGAAGACTTATGG - Intergenic
1052152036 9:25128985-25129007 ATTTTCTCCTAGGAGAGTAACGG - Intergenic
1052344764 9:27398349-27398371 ACTATCTCCTTGATAATTTAGGG + Intronic
1052628929 9:31012004-31012026 ATTTTCTTCTGGAATTTTTATGG - Intergenic
1052885666 9:33645990-33646012 ATTTTCTTCTAGAACATTTGTGG - Intergenic
1052950972 9:34211141-34211163 ATTCTCTCATTATAGATTTATGG + Intronic
1053178884 9:35950621-35950643 TTATTCTCCTTTAAGTTTTAGGG + Intergenic
1056077849 9:83059864-83059886 ATTTTCTCTTAGAAAATTGAGGG - Intronic
1058253070 9:102726786-102726808 GAGTTTTCCTTGAAGATTTAGGG + Intergenic
1058817688 9:108700467-108700489 ATTTTCTTCTAGAACATTTAAGG + Intergenic
1061559085 9:131391237-131391259 ATTTTCTTCTGGAGGCTTTAGGG + Intergenic
1187021584 X:15388043-15388065 GTTTTCTCCTTGAAGATTTGAGG - Intronic
1187048476 X:15673441-15673463 ATTTTCTCCCAGATGATTTGAGG - Intergenic
1187074869 X:15924400-15924422 GTTTTCTTCTAGAAGCTTTATGG + Intergenic
1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG + Intronic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1188079695 X:25821960-25821982 GTTTTCTTCTTGAGGTTTTATGG - Intergenic
1188811659 X:34658879-34658901 ATATTCTCCTTAAAAAATTAGGG + Intergenic
1188949763 X:36356460-36356482 ATTGTCTCCTTAAAGACATATGG + Intronic
1189009975 X:37037125-37037147 ATTGCTTCCTTGAAGATGTAAGG - Intergenic
1189038604 X:37518605-37518627 ATTGCTTCCTTGAAGATGTAAGG + Intronic
1189174115 X:38937014-38937036 ACTTTCTCCTTAAAGATCTAAGG - Intergenic
1189736511 X:44075328-44075350 ATTTTCTCCTATAAATTTTAAGG + Intergenic
1189933068 X:46035550-46035572 CTTTTGTCCTTGAAGAGTAATGG + Intergenic
1190470988 X:50779538-50779560 ATTTTCTCCATCAGGATTTCAGG + Intronic
1190607371 X:52159042-52159064 ATTTTCTCCTAGGAGGTTTCTGG - Intergenic
1191154574 X:57258329-57258351 ATTTTCTTCTCTAAGATTTATGG - Intergenic
1191752312 X:64556206-64556228 ATTTTCTCCTAGAAAACTTAGGG - Intergenic
1192154723 X:68735946-68735968 GTTTTCTTCTAGAATATTTATGG - Intergenic
1192621901 X:72685125-72685147 ATTTTCTCCATGAGGCTTAAAGG + Intronic
1192759605 X:74082788-74082810 ATTTTATTCTTCTAGATTTAGGG - Intergenic
1193225799 X:78982615-78982637 TTTTTCTCTTTTAAGATCTAGGG - Intergenic
1193261560 X:79412545-79412567 ATTCTTTCCTTGAAGAATTGTGG + Intergenic
1193317508 X:80080604-80080626 ATTTTCTCCTTCATTATTGAAGG + Intergenic
1193702068 X:84775291-84775313 ATATTCTACTTGAATATTTTCGG + Intergenic
1193814765 X:86091333-86091355 ATTTTTTTTTTGAAGATTTCAGG + Intergenic
1193947816 X:87760383-87760405 ATTTTCTACTTCTAGCTTTAGGG + Intergenic
1194002097 X:88443204-88443226 ATTTATTCCTTGTATATTTAAGG - Intergenic
1194169271 X:90562053-90562075 CTTTTATCCTAGAAGATTTTAGG + Intergenic
1194383510 X:93224055-93224077 ATTTCCTGCTTCAAGATTTCAGG + Intergenic
1195158542 X:102147868-102147890 AATTTATCCTTAAAGTTTTAAGG + Intergenic
1195454848 X:105056587-105056609 ATTTTCTCCTTCAGGATTCAGGG - Intronic
1195455648 X:105066196-105066218 ATTGTCTCCCTGAAGTATTAGGG - Intronic
1195692726 X:107641383-107641405 TTATTCTCCTTGAATATTCATGG + Intronic
1196304851 X:114088919-114088941 TATTTCTCCTTCATGATTTAAGG - Intergenic
1196500255 X:116372629-116372651 ATTTTCTCCTTGATCATTTTGGG + Intergenic
1196691690 X:118565626-118565648 AACTTTTCCTTGAATATTTAAGG - Intronic
1197130367 X:122998670-122998692 ATTATCTTCTAGAATATTTATGG + Intergenic
1197141344 X:123121240-123121262 ATGTGCTCTTTGCAGATTTACGG + Intergenic
1197514299 X:127405445-127405467 AAATTTACCTTGAAGATTTAAGG + Intergenic
1197564153 X:128060594-128060616 ATTTAGTCCTTTTAGATTTATGG - Intergenic
1197677842 X:129349211-129349233 ATTTTCTCCTTCACGTTTGAAGG - Intergenic
1197907906 X:131445824-131445846 ATTTTCTAATTGAAAATTTCTGG - Intergenic
1198460507 X:136858722-136858744 TTTTTCTCATTGAAGTTATAAGG - Intronic
1199022144 X:142893447-142893469 ATTTTATACTTTAAGTTTTAGGG - Intergenic
1199300029 X:146202457-146202479 GTTTTCTTCTAAAAGATTTATGG + Intergenic
1199334603 X:146603710-146603732 ATTTTCTTCTAGGAGGTTTATGG + Intergenic
1199536757 X:148911471-148911493 ATTTTCTCCTTGAGAATAAAAGG + Intronic
1199587394 X:149430665-149430687 ATTTTCTTTTTGGAGTTTTATGG - Intergenic
1199867072 X:151861479-151861501 ATTGTCTCCTTTAATACTTACGG + Intergenic
1200335332 X:155345118-155345140 GTTTTCTTCTAGTAGATTTACGG + Intergenic
1200351136 X:155496103-155496125 GTTTTCTTCTAGTAGATTTACGG - Intronic
1200515516 Y:4139828-4139850 CTTTTATCCTAGAAGATTTTAGG + Intergenic
1200762587 Y:7053797-7053819 AGTAGCTCCTTGAAGATTGAGGG - Intronic