ID: 922382989

View in Genome Browser
Species Human (GRCh38)
Location 1:225052180-225052202
Sequence CTTTGAATACAGATGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922382987_922382989 24 Left 922382987 1:225052133-225052155 CCATTAGAATGTAAGCTTCATCA 0: 1
1: 6
2: 61
3: 339
4: 1133
Right 922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG 0: 1
1: 0
2: 1
3: 20
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922382989 Original CRISPR CTTTGAATACAGATGAATAT TGG Intronic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905619919 1:39435903-39435925 CTTGGAATAAAAATGAAGATAGG - Intronic
907390868 1:54157439-54157461 TTTTGAACACATATGAACATGGG - Intronic
907643554 1:56217407-56217429 CTTTGAATTTAGAAAAATATAGG - Intergenic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
909042136 1:70667270-70667292 CTTTGAAGACAGATAGATCTGGG + Intergenic
910041174 1:82853023-82853045 CATTGAATTAAGATGAAAATTGG - Intergenic
910766436 1:90787270-90787292 GTTAGAATAAAGATGGATATAGG - Intergenic
911446044 1:97993782-97993804 CTCTGAATAACGATGATTATTGG - Intergenic
912603211 1:110960465-110960487 ATTTGAATACAAATGGTTATGGG + Intronic
912697362 1:111851494-111851516 CATTGAGTACAGATGAGTTTTGG - Intronic
913083659 1:115413915-115413937 CTTTCAATTAAGATGAATATAGG - Intergenic
920460208 1:206133893-206133915 ATTTGTATACAGATGTATAGGGG - Intergenic
920795996 1:209137250-209137272 CTTTTAATAGATATGAAAATAGG - Intergenic
921721348 1:218475264-218475286 CTTTGAAATCAGATCAATGTGGG + Intergenic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
923925466 1:238621977-238621999 CTTTGAAAACAAATGATTAGGGG - Intergenic
923995809 1:239492845-239492867 CTCTGAGTACTGATGAAAATTGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064336922 10:14451815-14451837 GTGTGAAAACAGATTAATATAGG + Intronic
1065410919 10:25427087-25427109 ATTTGACTATAGATTAATATAGG - Intronic
1067235680 10:44446968-44446990 CTTTGAAGACACAAGAATTTGGG - Intergenic
1068595095 10:58894754-58894776 CCAAGAATACAGATGAATTTGGG + Intergenic
1072375041 10:94805936-94805958 CTTTGACTTCAGATAAATTTCGG - Intronic
1072892085 10:99332616-99332638 CTTTGAATACAAACAAATCTGGG + Intronic
1073982618 10:109172300-109172322 CTTTTAATATAGAGGAATGTAGG + Intergenic
1074799021 10:116980094-116980116 CTTTGATTAAAGATGAATGTGGG - Intronic
1075032430 10:119032885-119032907 CTTTAAAAATAGATGAATAGTGG - Exonic
1075373768 10:121960970-121960992 CTTTAACGACTGATGAATATGGG - Intronic
1077636489 11:3845170-3845192 CATTGAATATTTATGAATATGGG - Intergenic
1080042280 11:27771356-27771378 CTTTGAAATCAGATGTATCTTGG - Intergenic
1080079910 11:28204624-28204646 AATTGAATAGAGATGAATCTGGG - Intronic
1080126492 11:28740593-28740615 CCTTGAATACAGCTGACTTTAGG + Intergenic
1080140577 11:28914375-28914397 GTATGTATACATATGAATATAGG + Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086139558 11:83480253-83480275 CTTTGAATACAGATGATAAAAGG + Intronic
1086809198 11:91284613-91284635 CTTTGGATTTAGATAAATATTGG - Intergenic
1087240525 11:95771071-95771093 CTTTGCATCAAGATGAATTTAGG - Exonic
1088287150 11:108200911-108200933 CTTTGAATGCAAATAAATACTGG - Intronic
1089052160 11:115555318-115555340 CTTTGCAATCAGATGAATATAGG - Intergenic
1089819791 11:121213935-121213957 TTTTGAAGACAGAAGAAGATTGG - Intergenic
1090149669 11:124369564-124369586 CTTTGGATACAGGTGATTGTTGG - Intergenic
1090836756 11:130459542-130459564 CTTTGAAGACGAAAGAATATGGG + Intronic
1091726496 12:2849958-2849980 CTTTTAACACAGCTGAATAGTGG + Intronic
1092028469 12:5263097-5263119 CTCTGCTTACAGATGAATTTTGG - Intergenic
1094179153 12:27573025-27573047 CTTGGAATGCAGATGTTTATTGG + Intronic
1094328812 12:29270301-29270323 CTTTGAATGCAGAAAAAAATAGG - Intronic
1095819780 12:46465232-46465254 CTTTGCATATAGATATATATTGG + Intergenic
1097171345 12:57115410-57115432 CTTAGAATTCAGATACATATAGG - Intronic
1098015783 12:66103288-66103310 CTTGGAATCCAGATGAAGAGTGG + Intergenic
1098015966 12:66104841-66104863 CATTAAATACAGGTGGATATTGG + Intergenic
1098594257 12:72253736-72253758 TTTTAATTACAAATGAATATTGG + Intronic
1099307651 12:80977981-80978003 AAATGAATACAGATTAATATGGG - Intronic
1099451611 12:82814690-82814712 CTTTAAAACCAAATGAATATTGG + Intronic
1100170086 12:91965073-91965095 CATTGAATTCAGAGAAATATTGG - Intergenic
1100357476 12:93844910-93844932 CTCCTAATACAGATCAATATGGG + Intronic
1100371717 12:93974862-93974884 CTTTGAGTACAGTTAAATAAAGG + Intergenic
1100722751 12:97376018-97376040 CTTTGAAATCAGATGGATTTGGG + Intergenic
1100725512 12:97404562-97404584 TTTTAAAAACATATGAATATTGG + Intergenic
1100957769 12:99928217-99928239 CTTTGAATTCAATTGAATTTGGG - Intronic
1102721434 12:115019842-115019864 CTCTGCAAACATATGAATATTGG + Intergenic
1105200994 13:18177474-18177496 ATTTGGTTACAGCTGAATATTGG - Intergenic
1107852440 13:44584146-44584168 CTTTAAATACAAAGGAATATTGG - Intergenic
1108871570 13:54993348-54993370 CTTTGAATAAACATGGAAATTGG + Intergenic
1109430538 13:62228202-62228224 CTTTAAATTCAGATGATAATAGG - Intergenic
1109982142 13:69923232-69923254 CGTTAAATACTGATGAAAATTGG + Intronic
1110467594 13:75819632-75819654 ATTTGACTAAAGTTGAATATTGG - Intronic
1112187428 13:97141125-97141147 CTCTGAAAAAAGATGATTATAGG + Intergenic
1114804686 14:25821347-25821369 ATTTGATTACAGATGAGTCTGGG - Intergenic
1115372873 14:32638242-32638264 CTTTGAGTACTGATGAAGACCGG + Intronic
1116010823 14:39349907-39349929 CTTCAAATACAGATGATTAAAGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1120833892 14:89023167-89023189 CTGGGAATACAAATGAACATTGG + Intergenic
1121031956 14:90665682-90665704 CTTTTAATAGTGATGAATTTTGG - Intronic
1122257669 14:100490952-100490974 CTTTGAATGCAGATGAGAGTAGG + Intronic
1124225983 15:27895385-27895407 CTCAGAATACAGAAGAATGTGGG + Intronic
1126181199 15:45786848-45786870 TTTTTAATACAGTAGAATATGGG - Intergenic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1126926135 15:53588763-53588785 CTATGAATACATATCCATATTGG + Intronic
1126954469 15:53916962-53916984 CTTTGAATATAGTTAAATATTGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127831074 15:62752080-62752102 CTTGGAATACAGATAACTTTGGG + Intronic
1128523742 15:68393151-68393173 CCCTGAAGACAGATGAATAGAGG + Intronic
1128815977 15:70608566-70608588 CTTTGGATTCAGATAAATCTGGG + Intergenic
1128888071 15:71306437-71306459 CTTTGAAGAAAGATAAATCTGGG - Intronic
1131844182 15:96471329-96471351 CTTTGAAGACAGATTAAAAACGG - Intergenic
1132403513 15:101528476-101528498 CTTTGAGCAATGATGAATATTGG - Intergenic
1134163585 16:11912893-11912915 CTTTGAAAACTAAAGAATATAGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134420120 16:14079075-14079097 CTTTGAATACAGTCGTGTATAGG + Intronic
1137990829 16:53153320-53153342 GTTTGTATACAGATGAGAATGGG + Intronic
1138697659 16:58830473-58830495 GTGTGAAAACAGATGAATACAGG + Intergenic
1138763794 16:59575896-59575918 TTCTGAAAACAGATGAATATTGG + Intergenic
1140669888 16:77268034-77268056 CTTTGAAGAATGTTGAATATTGG + Intronic
1140782652 16:78310780-78310802 CATTGAAAAGAGATGAAAATGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143291275 17:5831432-5831454 CTTTGGTTTCAGATGAATTTAGG - Intronic
1144412936 17:15019105-15019127 CTTTGGCTACAGAAGAAGATTGG + Intergenic
1145189243 17:20824031-20824053 CTTTGAATACAGTTGGATACAGG + Intergenic
1148983171 17:51597218-51597240 CTTTGAATTCAGATAGATCTTGG + Intergenic
1149048427 17:52275320-52275342 CTTTGAAGACAGATACAAATGGG + Intergenic
1149377896 17:56064305-56064327 CTGTTAGTACAGAGGAATATGGG - Intergenic
1150077666 17:62206923-62206945 CTTTGAATACAGTTGGATACAGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150720007 17:67606383-67606405 CTTTGAAGGCAGTTGAATTTGGG - Intronic
1154080876 18:11255254-11255276 ATGTGAATACAGGTGAATACAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155519368 18:26653466-26653488 CTTTGAAGGAAGAGGAATATGGG - Intronic
1155541715 18:26875234-26875256 GTTTAACTACAGCTGAATATGGG + Intergenic
1156670673 18:39465589-39465611 GTTTGAATACTCATGAATTTTGG + Intergenic
1158283366 18:55851822-55851844 CTTCGAATAGAGACTAATATTGG - Intergenic
1158652976 18:59304125-59304147 TTTCGAATAAAGATGCATATAGG - Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1159230286 18:65598456-65598478 CTTGGAATATATTTGAATATAGG - Intergenic
1159545049 18:69830318-69830340 CTTTAAATACAGTTGTATGTGGG - Intronic
1160062068 18:75539858-75539880 CTATGATTTCAGATGAGTATTGG - Intergenic
1160325741 18:77946378-77946400 GTTTGGATACTGATGAATTTAGG - Intergenic
1165217520 19:34286810-34286832 TCTTGAATACACAGGAATATTGG + Intronic
1167659363 19:50787021-50787043 CTTTAAATATATATAAATATAGG + Intergenic
926441075 2:12889509-12889531 CTTTGATTAGAGATTAAGATGGG - Intergenic
926952762 2:18261466-18261488 CTTTGAATACTGAGGAGTGTAGG - Intronic
927347055 2:22057225-22057247 ATTTAAAGCCAGATGAATATAGG + Intergenic
928637506 2:33262792-33262814 CTGTGGATGCAGATGAATAGTGG - Exonic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
932076196 2:68665368-68665390 CTTTAAACACAGATCATTATAGG + Intergenic
934837061 2:97600334-97600356 CTTTGAAGAATGTTGAATATTGG + Intergenic
934933425 2:98446376-98446398 CTTTGAAGAAAGATGAATGATGG + Intronic
936751516 2:115647884-115647906 CATTGAAAACACATGAATTTTGG + Intronic
936925878 2:117736466-117736488 CTTTGAAATGAGATGAACATGGG - Intergenic
938113037 2:128581784-128581806 CTCTGAATACAGAGGACTTTAGG + Intergenic
938694984 2:133826964-133826986 CTTTGGATACAAATGAAAAAGGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939602187 2:144206150-144206172 CTTTGAATGTAGATACATATTGG - Intronic
939681061 2:145133346-145133368 CTTTTAATGCAGATGATTAATGG + Intergenic
939876500 2:147584763-147584785 CTTTTAAGAAAGTTGAATATTGG + Intergenic
940591737 2:155737553-155737575 CTGAGAATTCAGATGAATAGAGG - Intergenic
941273825 2:163464783-163464805 TTTTGAATACAGAAGACAATAGG - Intergenic
942003601 2:171675610-171675632 CTAAGAATCCTGATGAATATGGG - Intergenic
942826535 2:180184364-180184386 GTTTGACTATAGATGAAGATGGG + Intergenic
944240373 2:197480189-197480211 TTCTGAAGACACATGAATATAGG - Intergenic
945401128 2:209384587-209384609 CTCTGAATAAAGATGAATATAGG + Intergenic
947105751 2:226666211-226666233 TTTTGAATTCAGACGAATGTGGG - Intergenic
947881609 2:233519104-233519126 CTTGGAATACAGATGGGTACAGG + Intronic
1169626916 20:7581477-7581499 TTTTGAATAAAGAGGAATCTAGG - Intergenic
1169938634 20:10912804-10912826 CTTTGAATTGAGATGAACCTGGG - Intergenic
1170575093 20:17656401-17656423 ATTTGAAAAAAAATGAATATGGG - Intronic
1170999725 20:21400587-21400609 CATTGAAAACAGACGAAGATAGG + Intergenic
1172413891 20:34748282-34748304 CTTTGAATTCAGGAAAATATAGG + Intronic
1173169091 20:40708460-40708482 CTCTGAATTCAGATCAACATAGG + Intergenic
1173467929 20:43298765-43298787 CATTGAATACAGAAGAAAATAGG - Intergenic
1176724948 21:10423649-10423671 CTTTGAAAACAAATGAAATTAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183921714 22:41174898-41174920 CTTTGAACACCTATGTATATAGG - Intronic
1184874757 22:47267195-47267217 CCATGAAGACAGATGCATATGGG - Intergenic
949297129 3:2537964-2537986 CCTTCAAAACAGATGAATTTTGG - Intronic
949361892 3:3241207-3241229 CTTTGAATATATATCAATCTTGG - Intergenic
949526037 3:4905111-4905133 TTTTGAAGACAGTTGAATCTGGG + Intergenic
950374740 3:12561960-12561982 CCTTGAATACAGCTGTATACTGG - Intronic
951444248 3:22759014-22759036 ATTTTATTTCAGATGAATATGGG + Intergenic
951544770 3:23813421-23813443 CTTTTAAGAGAGCTGAATATTGG - Intronic
952249548 3:31638122-31638144 GTTTGAATACATTGGAATATAGG + Intergenic
952539096 3:34347272-34347294 CTATGAAGACAGAGGCATATGGG - Intergenic
956689390 3:71861973-71861995 CTAAGAATACAAATGGATATTGG - Intergenic
957211673 3:77266975-77266997 CTTTGAAAAGAAATAAATATTGG - Intronic
957733136 3:84168698-84168720 GTATGAATAGAGATGCATATGGG - Intergenic
957863167 3:85985654-85985676 CTTTAAATGTAGATGAATTTAGG + Intronic
958499906 3:94891910-94891932 CATTGATTACCAATGAATATTGG + Intergenic
959699416 3:109284675-109284697 CTTAGAAGAGAGATGAATTTAGG - Intergenic
961542990 3:127612815-127612837 CTTTGGATTCAGATGCATCTGGG + Intronic
962725439 3:138221631-138221653 CTTTGGATACAAAGGAATACAGG - Intronic
963102109 3:141617736-141617758 CTTGGAAAACACAGGAATATAGG + Intergenic
963509935 3:146234578-146234600 CCTTGAATGCAAATGAATTTGGG + Intronic
964419625 3:156487705-156487727 CCCTTAATACAGAAGAATATTGG - Intronic
965805650 3:172538717-172538739 TGTTGAATACAGAGGAAAATAGG + Intergenic
966118780 3:176498601-176498623 CTGTGAAAACAGATTAATACAGG - Intergenic
966289661 3:178341261-178341283 CTTTGGACACAGGTGGATATGGG + Intergenic
967367608 3:188705550-188705572 ATTTGCATAAACATGAATATTGG - Intronic
967423350 3:189298038-189298060 CTTTGCATACATATGAGTTTGGG - Intronic
970379187 4:15489536-15489558 CTTTGAGTACAGATTAATTGCGG - Intronic
973153937 4:46924581-46924603 CTTTAAAGACAGTAGAATATTGG - Exonic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974589675 4:63928535-63928557 CCTTGAATACACATGTTTATTGG + Intergenic
976637401 4:87300708-87300730 CTTTGCATACAGTTGAAGATTGG + Intergenic
977438600 4:97034145-97034167 TTTTAAATAAAGATGAAAATTGG + Intergenic
977978113 4:103290913-103290935 CTTTGAAGAAATATGAGTATGGG + Intergenic
978182711 4:105819486-105819508 CTCTGCATATAGATGAGTATTGG + Intronic
978825069 4:113012721-113012743 CTTGGAATACAGGTAAATAATGG - Intronic
979100036 4:116601642-116601664 CTTAGAATAGAGATGAATTATGG - Intergenic
979729074 4:123999889-123999911 TTTTTCATACACATGAATATAGG - Intergenic
980696866 4:136368362-136368384 CTTAGAAAATAGATGAATTTTGG - Intergenic
980751157 4:137091192-137091214 CTTTGAATACAGGGAAATAGAGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982560485 4:156923410-156923432 CATTGAATACAATTGAATAGTGG - Intronic
982858363 4:160414772-160414794 CTCTGTATACAAATGAATACTGG - Intergenic
982915139 4:161198899-161198921 ATTTGAATAGAAATTAATATCGG - Intergenic
983052238 4:163061943-163061965 TTTTGAGTAAAAATGAATATAGG + Intergenic
983305449 4:165979103-165979125 ATTTGAATACAGAGTAATAATGG - Intronic
985215764 4:187651991-187652013 CTCAGAATACATATCAATATAGG + Intergenic
986457419 5:7933298-7933320 TTCTGAATACAGTTGAAGATTGG + Intergenic
986647262 5:9929765-9929787 CTTTGCAGAAAGATGAATGTGGG - Intergenic
987345975 5:16979281-16979303 CATTGAATGCATATAAATATAGG + Intergenic
988185595 5:27857548-27857570 CTGAGAATAGAGAAGAATATGGG + Intergenic
989379556 5:40799585-40799607 CTTTGATTACTGATGTATTTGGG + Intergenic
990719776 5:58681291-58681313 CAATCATTACAGATGAATATTGG + Intronic
992325031 5:75652004-75652026 CTTTGAATCCAGATGAACCCTGG - Intronic
992364331 5:76076640-76076662 CTATGAATTCAGTTTAATATTGG - Intergenic
992626994 5:78645227-78645249 CTTTGAAAACAGAGGTGTATGGG + Intronic
992838967 5:80668481-80668503 CTTTGGACACTGATGAACATGGG - Intronic
993216824 5:85035323-85035345 CTTAGAAAATAGATGAATAGGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994954996 5:106517714-106517736 CTTTGAATACATATGATTAGGGG - Intergenic
997646330 5:135484469-135484491 CTTCTAATTCAGATGAATGTGGG + Intergenic
998194019 5:140050953-140050975 CTTTTAAAACGGATGAATTTTGG - Intergenic
998751902 5:145332069-145332091 CTTTGAAGAATGTTGAATATTGG + Intergenic
999542449 5:152588188-152588210 CTTTGAAGAATGTTGAATATTGG - Intergenic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
1000702908 5:164475037-164475059 CTTGGAGAACAGATGAATATTGG + Intergenic
1002696640 5:181096666-181096688 TGTTGAATACAGGTGAATGTAGG - Intergenic
1002697982 5:181102707-181102729 TGTTGAATACAGGTGAATGTAGG + Intergenic
1004089623 6:12487824-12487846 CTGTGAATACAGGAGAATAGAGG - Intergenic
1004122771 6:12840750-12840772 CTTTGAATAGACATAAATTTGGG - Intronic
1005204931 6:23391951-23391973 CTTTTACTACAAATGAATAGTGG - Intergenic
1006407513 6:33853828-33853850 ATTTGAAGCCAGATGAATCTAGG + Intergenic
1006541320 6:34742435-34742457 CTTTGAATAGCCATGATTATAGG - Intergenic
1006548517 6:34800613-34800635 TGCTGAATACAGATAAATATTGG + Intronic
1007866309 6:44973650-44973672 GTGTGAAAACAGATTAATATAGG - Intronic
1008192161 6:48473534-48473556 CTCAGAATACATATGAATTTCGG - Intergenic
1009312811 6:62176711-62176733 CTTTGATTATAGAAGACTATAGG + Intronic
1010815823 6:80357120-80357142 CATTGAATACAGTTTAATAATGG + Intergenic
1011121537 6:83959015-83959037 CTTTGAAAACTGGTGAATAAAGG + Intronic
1012177578 6:96107641-96107663 CTTGGAATACAGATTAGTAATGG - Intronic
1012187350 6:96235648-96235670 CTTTGGAGTCAGATGAATCTGGG - Intergenic
1012233361 6:96785608-96785630 ATTGGAATACAGCTGTATATTGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1016945378 6:149527457-149527479 CTTTGAAGCCAGATAAATGTAGG - Intronic
1017396906 6:154011516-154011538 TGTTGAATACACATGCATATAGG - Intronic
1017472855 6:154757305-154757327 CTTTTTATACCTATGAATATTGG + Intronic
1017700916 6:157070315-157070337 CTTTGAATAAAAATCTATATTGG + Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1020321482 7:6941680-6941702 CTTTGAATACTAAGGAAAATAGG + Intergenic
1022763683 7:33385381-33385403 CTTTGAATACAGTTGGGTTTTGG + Intronic
1023535850 7:41208862-41208884 CATTGAATCCAGATAAATTTGGG + Intergenic
1023673491 7:42604825-42604847 CTTACAATACAGATTAAAATAGG + Intergenic
1027493921 7:78863681-78863703 CTTTGCTCACAGATAAATATAGG + Intronic
1027601872 7:80249285-80249307 CATTGAATAAAGATAAAGATGGG - Intergenic
1027895545 7:84039093-84039115 CTTTGCATAGAGGTGTATATAGG + Intronic
1028301179 7:89203214-89203236 ATTAGAATACAGATAAACATTGG + Intronic
1028819715 7:95193385-95193407 TTTTGAATACAAAGCAATATTGG + Intronic
1028835179 7:95366699-95366721 CTTTGAATTCAGATGGATCTGGG + Intronic
1029350237 7:100008232-100008254 CATTGGACACAGATGAATTTAGG - Intergenic
1030000882 7:105060259-105060281 CTGGGATTACAGGTGAATATTGG + Intronic
1031006730 7:116481890-116481912 TTTTGAATTAATATGAATATAGG + Intronic
1034130014 7:148707042-148707064 CTTTTAATATATATGAATGTAGG - Intronic
1034983529 7:155493799-155493821 CTTTGAATACAAATAATTTTGGG - Intronic
1035654023 8:1292072-1292094 CTCTGAAGACAGATGAATTGTGG + Intergenic
1037038718 8:14203619-14203641 GTTTGAATGAAGATGAATAGAGG + Intronic
1037574826 8:20191921-20191943 CTTTTATTACAAATGATTATTGG - Intergenic
1043066223 8:75574240-75574262 ATTTGAATACAGAACAATATGGG + Intergenic
1045705255 8:104915309-104915331 CTTTTAAGACTGTTGAATATTGG + Intronic
1045844718 8:106620617-106620639 ATTTCATTACAGTTGAATATTGG - Intronic
1048098936 8:131325985-131326007 CTTTGAAAACAGATTATTAGTGG + Intergenic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1053445019 9:38146139-38146161 CTTTGAATGCAGATGAGCAGGGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053724670 9:40987309-40987331 CTTGGAATAAAGATAATTATAGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054341301 9:63864690-63864712 CTTGGAATAAAGATAATTATAGG - Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1054955813 9:70908613-70908635 CATTGAATCTAGATGAATTTGGG - Intronic
1055910147 9:81341341-81341363 CATTAAATATAGATCAATATGGG - Intergenic
1057798682 9:98176009-98176031 CATTTAATAAAAATGAATATGGG + Intronic
1059771625 9:117431904-117431926 CCTTGAATATTGATGAGTATTGG - Intergenic
1059912526 9:119061350-119061372 CTTAGAATACACAAAAATATGGG + Intergenic
1060900868 9:127256889-127256911 CTGTGAATACAGGTAAATACAGG - Intronic
1185919203 X:4070488-4070510 CTTTAAAAAGAGATGAGTATAGG + Intergenic
1186013238 X:5161614-5161636 TTCTGAACACAGATGAACATAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1190516059 X:51224598-51224620 TTTTGTCTACAGATGAATAAAGG + Intergenic
1191085102 X:56558116-56558138 ATTTGACTAGAGGTGAATATTGG - Intergenic
1192344106 X:70287201-70287223 CTTTAAATACTGATGACTAGAGG - Intronic
1193647832 X:84089978-84090000 CTTTGAACATACATGAATATAGG + Intronic
1193966779 X:87997509-87997531 CTTTGAATATATATGAGAATGGG + Intergenic
1194834520 X:98665381-98665403 ATTTGAATACAGATAATTAGGGG + Intergenic
1195613818 X:106897011-106897033 CTTTGGAAGCAGATGAACATGGG - Intronic
1196030596 X:111091850-111091872 CTTTGAATACAAAAGAACCTGGG - Intronic
1197358638 X:125469417-125469439 CTTTGAAGTCAGAACAATATTGG - Intergenic
1197604642 X:128571040-128571062 CTTCAAATACAGATGGATGTGGG - Intergenic
1198138864 X:133782694-133782716 CTTCAAATACAAATGAATTTTGG + Intronic
1198698204 X:139366546-139366568 ATTGCAATACAGATGAATTTGGG + Intergenic
1199019643 X:142862613-142862635 CTAAGAATACAGGTGGATATAGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201629775 Y:16058098-16058120 ATTTGAATATAGATGAAGATAGG - Intergenic