ID: 922383066

View in Genome Browser
Species Human (GRCh38)
Location 1:225052895-225052917
Sequence TTGGCTTCACGAAGCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922383066 Original CRISPR TTGGCTTCACGAAGCCATCA GGG Intronic
900863853 1:5253289-5253311 TTGGCTTCAAGGAGACATTAAGG - Intergenic
905472957 1:38207101-38207123 TTGGCTTCCCCAAGACCTCAGGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907831540 1:58068942-58068964 TGGGCTTCACGAGGCTTTCAGGG + Intronic
913012430 1:114697546-114697568 GTGGCTTTAGGATGCCATCAGGG - Intergenic
914971955 1:152313918-152313940 TCGGCTTCCAGAAACCATCATGG - Exonic
917692376 1:177482613-177482635 TAGGCTTCATGAAGGCAGCAAGG - Intergenic
922383066 1:225052895-225052917 TTGGCTTCACGAAGCCATCAGGG + Intronic
922980529 1:229822672-229822694 TTGTCTTCAGGAAGTCAGCATGG + Intergenic
1064784216 10:18876172-18876194 GTGGATTCCCGAAGCCATCTTGG + Intergenic
1066575880 10:36824238-36824260 TTGCCATCATGAAGCCATAATGG - Intergenic
1067140769 10:43654645-43654667 TCGGCTTCCCAAAGGCATCATGG + Intergenic
1067762102 10:49056233-49056255 TGGACTTCATGAAGCCAGCAGGG - Intronic
1068971497 10:62962939-62962961 CTGGATTCACAAAGTCATCAAGG + Intergenic
1069417528 10:68214193-68214215 TTGGCTCCAGGTAGCCATTAGGG - Intergenic
1069614282 10:69797086-69797108 TTGACTCCACGAAGCCGTCAGGG + Intergenic
1069738017 10:70670260-70670282 CTGGCTTCATGCAGCCAACACGG + Intergenic
1075011028 10:118870340-118870362 TGAGCTTCATGAGGCCATCAAGG - Intergenic
1075181936 10:120219376-120219398 GTAGCTCCACGAAGCCACCAGGG + Intergenic
1079221879 11:18570297-18570319 TTGGCTTCAAGAAGCAAATAGGG + Exonic
1079596554 11:22256682-22256704 TTGGCTTCACTTAGCTTTCATGG + Intronic
1088782128 11:113145990-113146012 CTGGCTTAACGATGCCATAAAGG + Intronic
1089731979 11:120524951-120524973 TTGGCTTCTGGAGCCCATCAGGG + Intronic
1091341659 11:134820179-134820201 TTGTCTTAACCAAGCAATCAAGG + Intergenic
1096297832 12:50398777-50398799 TTGACTTTAAGAAGCCTTCATGG - Intronic
1099989477 12:89708262-89708284 TCGGCTTCACGAAGCCGCCTCGG - Intronic
1101714951 12:107302568-107302590 GTGGCTGCACAAGGCCATCAGGG + Intergenic
1108248810 13:48544556-48544578 TTGGCTCCTGGAAGCCAGCATGG + Intergenic
1109815499 13:67577218-67577240 ATGGCTTCTTGAAGCCACCAGGG - Intergenic
1110976254 13:81839403-81839425 GTAGCTTCACCAAGCCATGAAGG - Intergenic
1113013632 13:105800584-105800606 TTGGCTTCATGAAGGCCTGAAGG - Intergenic
1116486779 14:45459297-45459319 TTGTCTTCAAGAAGCCTTCCAGG + Intergenic
1120844471 14:89113933-89113955 TTGAATTCATGATGCCATCATGG + Intergenic
1121512829 14:94525326-94525348 TTGGCAGGACGAAGCCACCAAGG - Intergenic
1121709443 14:96026745-96026767 ATGTCTTCACGGAGCCATGAAGG + Intergenic
1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG + Intronic
1136450402 16:30351502-30351524 TTCACTCCAAGAAGCCATCAGGG - Exonic
1136995272 16:35184705-35184727 TTGGCTTCAGGAATACTTCAGGG - Intergenic
1145313564 17:21714692-21714714 TTGTCTTCATGCTGCCATCATGG - Intergenic
1148017233 17:44530492-44530514 CTCGCTTCACTAAGCCAGCAAGG - Intergenic
1155530518 18:26761777-26761799 CTTCCTTCATGAAGCCATCAGGG - Intergenic
1158562515 18:58526642-58526664 TTGGCTTCATGGAGACCTCAAGG - Intronic
1159550031 18:69885389-69885411 CTGGTTTCAAGAAGCCATTACGG + Intronic
1160582345 18:79891293-79891315 GTGGCTTCAGTAAGCCATGATGG - Intronic
1160981168 19:1817278-1817300 AGGTCTTCACGAAGCCCTCAAGG + Exonic
1162494817 19:11017774-11017796 GTGGCTCCAAGATGCCATCAGGG + Intronic
1163125897 19:15244081-15244103 GTGGCTTCTCGAGGCCATCTTGG - Intronic
1165369669 19:35396899-35396921 TTGGCTAAACGCAGGCATCAGGG - Intergenic
926572781 2:14547528-14547550 TAGGCTGCAAGAGGCCATCAAGG - Intergenic
934083849 2:88492865-88492887 TTGACTTAACCAAGCCAACAAGG + Intergenic
935334673 2:102005504-102005526 GCGGCTTCACGAAGCCACCAAGG + Intronic
936645978 2:114373512-114373534 TTGGCTTCTGGAAGTTATCATGG + Intergenic
943537903 2:189175465-189175487 TTGGCTCCACAAAGTCATCAGGG - Intronic
944462873 2:199969952-199969974 TTGGGTTCCCTAAGCCAGCATGG - Intronic
1171499354 20:25581189-25581211 TTGGCTTCCCAAAGCGATGATGG - Intronic
1172103087 20:32497436-32497458 AAGGCTTGACAAAGCCATCAGGG + Intronic
1174714099 20:52738287-52738309 TGGGTTTCATGAAGCAATCACGG - Intergenic
1175390164 20:58622044-58622066 TGAGCTTCACGCAGACATCATGG - Intergenic
1178851885 21:36219391-36219413 TTTGTTTCTCGAAGTCATCAGGG + Exonic
1181772993 22:25140306-25140328 TTTGCTTCATTAAGCCAGCAAGG + Intronic
1183556381 22:38530514-38530536 TTGGCTTCACAAAAGCAACAGGG + Intronic
1185071009 22:48655798-48655820 TTGGCTTCAGGAAGCCAGGCAGG - Intronic
952167359 3:30765382-30765404 GTGGCTTCCTGAAGACATCATGG - Intronic
956164522 3:66386284-66386306 GTGGCTTCAGGAAGTCATCTGGG + Exonic
960589726 3:119353861-119353883 TTGCCTTCAAGAAGCCAAGAAGG - Intronic
963830254 3:150000130-150000152 ATGGCTTCACGAAGCCAAAGAGG + Intronic
965589719 3:170350966-170350988 TTGGCTTAAGCTAGCCATCATGG - Intergenic
966242632 3:177771571-177771593 TTGCCTTCCTGAAACCATCAAGG - Intergenic
967811494 3:193765026-193765048 TTGCCTTCACGATGTCATCCTGG + Intergenic
978227585 4:106356021-106356043 TTGGCTTCAGGCATCCATTAGGG - Intergenic
980316000 4:131200864-131200886 TTAGCATCACTAATCCATCAGGG - Intergenic
991416415 5:66397351-66397373 GTGGTTCCATGAAGCCATCATGG - Intergenic
992067057 5:73118838-73118860 TTGGCATCACAAGGCCATGAGGG + Intergenic
992614005 5:78532505-78532527 TTAGCTTCATGATGTCATCAGGG - Intronic
1004015053 6:11724505-11724527 TAGGCTTCACTTAGACATCATGG - Intronic
1006304279 6:33209616-33209638 ATGCCTTCAGGAAGCCATAATGG + Exonic
1007033832 6:38654605-38654627 GTGGCTTCACAAAATCATCAGGG - Intergenic
1010987596 6:82442855-82442877 TTGGCTTAAAGATGTCATCAAGG - Intergenic
1015200543 6:130575032-130575054 TTGTCTCCACAATGCCATCAGGG - Intergenic
1018277123 6:162145066-162145088 TTGACTACAGGAAGTCATCAGGG - Intronic
1019074891 6:169379223-169379245 TTGGCTTTGCCACGCCATCATGG + Intergenic
1021508688 7:21411955-21411977 CTGGCTTCAAGAAGCCCACAGGG - Intergenic
1026438083 7:70417304-70417326 TTCGCATCACAAAACCATCAGGG + Intronic
1027638083 7:80701136-80701158 ATGGCTTCAGGAACACATCAAGG + Intergenic
1029100506 7:98126037-98126059 TAGGCTTTAGGAAGCCAGCAGGG + Intronic
1029159476 7:98541381-98541403 TTGCCCTCACAAAGCCTTCAAGG + Intergenic
1031168224 7:118257075-118257097 ATGGCTTCACGTAGTCAACATGG + Intergenic
1035279472 7:157768510-157768532 TTGTCTTCAAGGAGCCATGATGG + Intronic
1035748517 8:1978853-1978875 TGGGCTCCAGGAAGTCATCATGG + Intronic
1036066813 8:5390030-5390052 TTGGTTTAAGAAAGCCATCAGGG - Intergenic
1047324820 8:123826125-123826147 TGGGCTTCAGGGAGCCATAAGGG + Intergenic
1049330217 8:142046486-142046508 TTCCCTTCACGAAGCCAGCCAGG + Intergenic
1056752721 9:89363822-89363844 CTGGCTGCAGGACGCCATCAGGG - Intronic
1057978330 9:99630726-99630748 TTGGCTTCACGCAGCCAAAAAGG - Intergenic
1058480315 9:105386647-105386669 TTGGCTTCCCCAGGCCATCCTGG - Intronic
1059276386 9:113100698-113100720 TTGTCTTCTGGAAGCCATGAAGG - Intergenic
1061313224 9:129777497-129777519 TTGGCTTCTCGCAGCAAACAGGG - Intergenic
1061976466 9:134070358-134070380 TTGGCTCCATGGAGCCATCCGGG - Intergenic
1186338528 X:8618334-8618356 TTGGCTTCAGGGATCAATCAAGG - Intronic
1187295328 X:17994128-17994150 TTGCCTTCAGAAAGCCAACATGG + Intergenic
1187560341 X:20397093-20397115 GTGGCTTCACGAAGTCATTGAGG + Intergenic
1192800447 X:74460317-74460339 TTGGTTTCATGAATCCATGATGG + Intronic
1194069345 X:89300860-89300882 TTGGCTCCACGTAGCTATGATGG - Intergenic
1195490822 X:105467598-105467620 GTGACTTCAAGAAGTCATCAGGG + Intronic
1197041417 X:121940166-121940188 GTGGCTTGAGGTAGCCATCACGG + Intergenic
1198760875 X:140031331-140031353 ATGGGTGCACGAAGCCACCATGG - Intergenic
1198950779 X:142068985-142069007 TTGCTTTCTCTAAGCCATCATGG + Intergenic
1198973005 X:142302575-142302597 TTTGCTTCATGCAGCCAACATGG + Intergenic