ID: 922384177

View in Genome Browser
Species Human (GRCh38)
Location 1:225065001-225065023
Sequence CAGTTTCCTCAAAGGTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3251
Summary {0: 1, 1: 0, 2: 38, 3: 394, 4: 2818}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922384173_922384177 -9 Left 922384173 1:225064987-225065009 CCCTGTCTGTACCACAGTTTCCT 0: 1
1: 0
2: 14
3: 163
4: 1036
Right 922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG 0: 1
1: 0
2: 38
3: 394
4: 2818
922384174_922384177 -10 Left 922384174 1:225064988-225065010 CCTGTCTGTACCACAGTTTCCTC 0: 1
1: 0
2: 68
3: 786
4: 3087
Right 922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG 0: 1
1: 0
2: 38
3: 394
4: 2818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922384177 Original CRISPR CAGTTTCCTCAAAGGTAAAT TGG Intronic
Too many off-targets to display for this crispr