ID: 922386049

View in Genome Browser
Species Human (GRCh38)
Location 1:225084236-225084258
Sequence GGGATAAGGAGGCAATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922386042_922386049 14 Left 922386042 1:225084199-225084221 CCCCTTCTTCTTCTTGAAGATAA 0: 1
1: 0
2: 3
3: 36
4: 492
Right 922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG 0: 1
1: 0
2: 5
3: 43
4: 196
922386043_922386049 13 Left 922386043 1:225084200-225084222 CCCTTCTTCTTCTTGAAGATAAT 0: 1
1: 0
2: 5
3: 54
4: 614
Right 922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG 0: 1
1: 0
2: 5
3: 43
4: 196
922386044_922386049 12 Left 922386044 1:225084201-225084223 CCTTCTTCTTCTTGAAGATAATT 0: 1
1: 0
2: 3
3: 54
4: 463
Right 922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG 0: 1
1: 0
2: 5
3: 43
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922386049 Original CRISPR GGGATAAGGAGGCAATCAGC TGG Intronic
901077258 1:6563035-6563057 GGTATAAGGAGGCATTTGGCAGG + Intronic
902512206 1:16972557-16972579 GGGATGAGGAGGCGCTCTGCTGG + Exonic
902827296 1:18985359-18985381 AGGCCAAGGAGGCAATCAGGTGG + Intergenic
903485641 1:23688057-23688079 GGGACAAGGAGGCATTCTCCTGG - Intergenic
903662149 1:24984771-24984793 GGGAACAGGAGGCAACAAGCAGG - Intergenic
905172789 1:36118927-36118949 GAGATAAGGATGCATGCAGCTGG - Intronic
906657755 1:47561149-47561171 GGGAGAAGGAGGCATTCAGCAGG + Intergenic
907732901 1:57085287-57085309 GGGACAAGAAGGCAGACAGCTGG - Intronic
908661543 1:66442131-66442153 GGGATGAGGAGGCATTCTGCTGG - Intergenic
910034153 1:82770191-82770213 GGGATGAGGAAGCATTCTGCTGG - Intergenic
910582139 1:88840194-88840216 GGGATGAGGAGACAATCTGCTGG + Intergenic
910907111 1:92192722-92192744 GAGACAAGGAGGCAAGCAGACGG - Intergenic
912165276 1:107036081-107036103 GGGGTAAGGAAGCAATCATAAGG + Intergenic
912481014 1:109982152-109982174 GGGCTAAGAAGGAGATCAGCAGG - Intergenic
914459435 1:147869522-147869544 AGTATCAGGAGGCAATCAGTGGG - Intergenic
916151844 1:161800778-161800800 GGGATGAGGAGGCATTCTGCTGG + Intronic
916696991 1:167248457-167248479 GGGAAAGGGAGGCAAGGAGCAGG + Intronic
916732263 1:167576830-167576852 GGGACAAGGAGGCACTCAGGAGG - Intergenic
917958931 1:180127250-180127272 GGGCTAAGGAAGAAAGCAGCAGG - Intergenic
919076618 1:192821320-192821342 GGGATGAGGAGGCACTCTGCGGG + Intergenic
919199431 1:194335409-194335431 GGAATAAGGAGCCCAACAGCAGG - Intergenic
919513505 1:198494405-198494427 GGGTTGAGGTGGCAATGAGCTGG + Intergenic
919551115 1:198988971-198988993 GGGATAAGCAGAGTATCAGCTGG + Intergenic
922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG + Intronic
923058566 1:230449039-230449061 AGGATAAAGAGGGCATCAGCAGG - Intergenic
923464264 1:234234295-234234317 GTTATCAGGAGGCAATCAGATGG + Intronic
1063311484 10:4956697-4956719 GAGACAAGGAGGCAACCAGATGG - Intronic
1063316313 10:5009771-5009793 GAGACAAGGAGGCAACCAGATGG + Intronic
1064852069 10:19719428-19719450 GGAATATGGAGGCAATTAGTAGG - Intronic
1065921450 10:30396870-30396892 AGGTTAAAGAGACAATCAGCAGG - Intergenic
1067315984 10:45163273-45163295 GGGATAAGAATGGAATTAGCTGG + Intergenic
1069777065 10:70933411-70933433 TGGAAAAGGAGGCACACAGCGGG - Intergenic
1069905260 10:71728502-71728524 GGGATTAGCTGGGAATCAGCTGG - Intronic
1069940248 10:71950497-71950519 GGTATAAGGAGGCATTCGGCAGG + Intergenic
1072628952 10:97132511-97132533 GAGCCAAGGTGGCAATCAGCTGG - Intronic
1073428432 10:103470644-103470666 GGGAGAAGGAGGCTCTCAGTGGG - Intergenic
1074194904 10:111175113-111175135 GGGAGAAGGAGGCACTGAGCTGG + Intergenic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1074828871 10:117234388-117234410 GGGAAAAGGAGTCAATCAACAGG - Intergenic
1076357457 10:129863712-129863734 GGGACAATGAGGTAATCACCGGG - Intronic
1079452287 11:20607314-20607336 GGGATATGAAGGCATTCTGCTGG - Intronic
1081233208 11:40612382-40612404 GGGATAAAGAGGTAATGAGGAGG + Intronic
1083586423 11:63863114-63863136 GGGATAAAGAGACACACAGCAGG - Intronic
1083826251 11:65205586-65205608 GGGATAAGGAGGCAGAAGGCAGG - Intronic
1088144220 11:106655026-106655048 GGGATGAGCAGGCATTCTGCTGG + Intergenic
1088434187 11:109792624-109792646 GGGATGAGGAGGCATTCTTCTGG - Intergenic
1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG + Intronic
1089897543 11:121946797-121946819 GGGATAAGGAAGAAATCATGAGG + Intergenic
1091682480 12:2537035-2537057 GGCAGAAGGAAGCAGTCAGCAGG - Intronic
1094694481 12:32804224-32804246 GGGATGAGGAGGCATTCTGTTGG + Intronic
1094707038 12:32924117-32924139 GGGATGAGGAGGCATTCTGTTGG + Intergenic
1095291334 12:40483315-40483337 GGGACAAGTGGACAATCAGCTGG + Exonic
1095292062 12:40488311-40488333 GGGATAAAGGGACTATCAGCAGG + Exonic
1095292251 12:40489631-40489653 GGGATAACTAGACCATCAGCTGG + Exonic
1095324747 12:40875405-40875427 GGGTTAAGGAGGGGATGAGCAGG - Intronic
1096526085 12:52211194-52211216 GGGCCAAGGAGACACTCAGCCGG - Intergenic
1097185445 12:57194124-57194146 GGGAGATGGAGGCTGTCAGCGGG - Intronic
1099308594 12:80989700-80989722 CACATAAGGAGGCAATCTGCTGG - Intronic
1099910098 12:88820482-88820504 GGGGTAAGGAAGCAATCATGAGG + Intergenic
1100895369 12:99176217-99176239 GGGATCAGGAGGCATTCTACTGG + Intronic
1102150833 12:110688502-110688524 GGGAGAAGGCTGCAATGAGCAGG - Exonic
1102444849 12:112994154-112994176 GGGGTAAGGAGGTAATCATGAGG - Intronic
1103166277 12:118773245-118773267 GAGACAAGGAGGCAAGCAGATGG - Intergenic
1104721642 12:131047832-131047854 GGGAGAAGCAGGCCATCAGCAGG - Intronic
1106592279 13:31108313-31108335 GGGCTTTGGAGGCAAACAGCTGG + Intergenic
1106936586 13:34729269-34729291 TGGAAAAGAAAGCAATCAGCTGG + Intergenic
1108051760 13:46450511-46450533 GGGATGAGGAGACATTCAGCTGG + Intergenic
1108649601 13:52463713-52463735 GGGATAAGGAGGCATTCTGCTGG + Intronic
1109539531 13:63755701-63755723 GGGATGAGGAGACATTCAGCTGG - Intergenic
1109544313 13:63824133-63824155 GGGATGAGGAGACATTCAGCTGG + Intergenic
1110544618 13:76742771-76742793 GGGATAAGGAAGCATTCTGTTGG - Intergenic
1113359276 13:109613955-109613977 GGGATGAGGAGGCATTCTACTGG + Intergenic
1114582511 14:23775432-23775454 GGAAGAAGGAGGAAAGCAGCAGG + Intergenic
1115526560 14:34286023-34286045 GGGATAGTGAGGCAGTGAGCTGG - Intronic
1117066074 14:52014340-52014362 GGGGTAAGTAGCCAATCTGCTGG + Exonic
1117813750 14:59576551-59576573 GCGCTTAGGAGGCACTCAGCGGG - Intronic
1118453657 14:65926609-65926631 GGAAGAAGGAGGCAGGCAGCAGG - Intergenic
1121213113 14:92224064-92224086 GGGATAAGGGGGCCAGCAGATGG + Intergenic
1121271695 14:92641940-92641962 CCTACAAGGAGGCAATCAGCAGG + Intronic
1122110481 14:99497236-99497258 GGGAGAAGGAGACAAACAGGTGG - Intronic
1122276644 14:100594138-100594160 GGGATAAGGCGGCAAACAAGAGG + Intergenic
1125244774 15:37622182-37622204 GGGATAAAGAGGCATTATGCTGG - Intergenic
1127035011 15:54906241-54906263 AGGAGAAGGAGGAAATCTGCTGG + Intergenic
1127628717 15:60805415-60805437 GGGAGAAGGAGGCAGCCAGAAGG + Intronic
1129220419 15:74128908-74128930 GGGAGAAGGAGGCAGACGGCGGG - Intronic
1131137436 15:89948944-89948966 GGGATAAGGAGGCACTCTGTTGG + Intergenic
1131383062 15:91980477-91980499 GGGAGAAGGGGGTACTCAGCTGG + Intronic
1131488049 15:92838451-92838473 GGCAGAAGCAGGCACTCAGCTGG - Intergenic
1133749514 16:8713615-8713637 GGGAAAAGGATGCACTCAGCTGG - Exonic
1133750303 16:8720209-8720231 GGGGTCAGGAGGCACTCAACTGG - Intronic
1135270730 16:21067522-21067544 GGGATCAGGAGGCAGTTAGCTGG - Intronic
1138556905 16:57776110-57776132 GAGGTAAGGAGGTAACCAGCAGG - Intronic
1139076364 16:63454096-63454118 GGGATGAGGAGGAATTCTGCTGG - Intergenic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1143166712 17:4900549-4900571 GGGCTAGGGAGGCACTGAGCCGG + Exonic
1147210524 17:38870330-38870352 GGGATAAGGCGGCAAAGACCCGG - Intronic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1147732030 17:42609995-42610017 GGGATAAGAAGTCAAGCCGCAGG - Intronic
1147793961 17:43029597-43029619 GGGATAAGGAGGCATCAGGCCGG + Intergenic
1148983866 17:51603525-51603547 GGGATGAGGAGGCATTCTGCTGG + Intergenic
1151941270 17:77293541-77293563 GGAACAGAGAGGCAATCAGCAGG + Intronic
1152247506 17:79192805-79192827 GGTAAAAGGTGGCCATCAGCAGG - Intronic
1155465389 18:26129116-26129138 GGAATAAGGAGGCATTCTGCTGG - Intergenic
1156071797 18:33220221-33220243 GGGGTAAGGGAGCAATCAGTGGG + Intronic
1156168984 18:34458995-34459017 AGGTGAGGGAGGCAATCAGCAGG - Intergenic
1156375073 18:36506873-36506895 GGGATGAGGAGGCATTCTTCTGG - Intronic
1156616232 18:38788110-38788132 GTGATGAGGAGGCATTCTGCTGG - Intergenic
1157030590 18:43902566-43902588 GGGATACGGAGACATTCCGCTGG - Intergenic
1159694797 18:71542481-71542503 GGGATGAGGAGGCATTCTGCTGG - Intergenic
1164656079 19:29922977-29922999 AAGATAAGGACGAAATCAGCAGG + Intergenic
1166778025 19:45324070-45324092 GGGATAGGGAGGAACTCAGAGGG - Intergenic
1167778820 19:51581979-51582001 GGGAGTAGGAGGCAATCTACGGG - Intronic
1168137307 19:54360234-54360256 GGGAGAATGGGGCAAGCAGCGGG - Intronic
1168160770 19:54508851-54508873 GGGAGAATGGGGCAAGCAGCGGG + Intronic
926108234 2:10165831-10165853 GGGACCAGGAAGCAATCAGCAGG - Intronic
927088288 2:19691300-19691322 GGGATAAGTTGGCAGTTAGCAGG + Intergenic
928100556 2:28435031-28435053 GGGAGAAGGAGTCAAGAAGCAGG - Intergenic
928684577 2:33735337-33735359 GGGATGAGAAGGCATTCTGCTGG + Intergenic
929938823 2:46314968-46314990 GGGAGAAGGAGGCAGGCTGCTGG + Intronic
931149007 2:59551835-59551857 GGGATAGGGTTGCACTCAGCTGG + Intergenic
932144112 2:69304240-69304262 GGGAGGAGGAGGCAGGCAGCAGG - Intergenic
936830846 2:116644248-116644270 GGGATAAGGAGGCATTCTGCTGG + Intergenic
937576610 2:123430191-123430213 TGGATTAGGAAGCAAGCAGCAGG - Intergenic
939041630 2:137196233-137196255 GGGATGAGGAGGCATTCTGCCGG - Intronic
940068942 2:149662859-149662881 GGGATAGGTAGGCATTCAGAAGG + Intergenic
940083169 2:149827892-149827914 GAGATAAGGAGGAAATTGGCTGG - Intergenic
945131147 2:206573874-206573896 CGGATAAGGGGGCATTCTGCTGG + Intronic
945590148 2:211718976-211718998 GGGATAAGGGGGCTTTCTGCTGG + Intronic
945677578 2:212874405-212874427 GGGATAAGGAGGCATTCTGCTGG - Intergenic
1170248203 20:14247847-14247869 GGGATGAGGAGGAATTCTGCTGG - Intronic
1170974805 20:21152197-21152219 GGGAGAGGGAGGCAATGAGCTGG + Intronic
1173395489 20:42675858-42675880 GGGATAAAGAGGCATTCTGCTGG + Intronic
1173719851 20:45246932-45246954 GAGATGAGGAGGCATTCTGCTGG - Intergenic
1174435296 20:50502194-50502216 GGGAGGAGGAGGCATTCAGGGGG - Intergenic
1176799244 21:13407163-13407185 GGGATAAGAATGGAATTAGCTGG - Intergenic
1181324567 22:22034761-22034783 GGGACAAGGAGGCCATCATGGGG - Intergenic
1182866570 22:33609529-33609551 GAGAAAGGGAGGCATTCAGCAGG + Intronic
1183066580 22:35367760-35367782 GGGAGAAGGTGGCCATCTGCAGG - Intergenic
1183478859 22:38051922-38051944 GGGAGGAGCAGGCAATCAACTGG - Intergenic
1184815696 22:46867871-46867893 GGGATGAGAAGGCATTCTGCCGG - Intronic
949659864 3:6266744-6266766 GGGATGAGGAGGCATTCTGCTGG - Intergenic
950400092 3:12763232-12763254 GGGAGTAGGAGGCAAACAGAAGG - Intronic
951598290 3:24342347-24342369 GGGAGAATGAGGCATCCAGCAGG + Intronic
953083227 3:39641184-39641206 GGAATAAGGAGGCAACCAACAGG - Intergenic
954503858 3:51049440-51049462 GGGATCAGGAGGCATTATGCTGG + Intronic
955033010 3:55238882-55238904 GGGAAAAGGAATCAAGCAGCAGG + Intergenic
955213300 3:56962096-56962118 GGGAGAAGGAGGAAATTATCAGG - Intronic
955411732 3:58659898-58659920 GGGATAATGAGGAAAAGAGCTGG - Intronic
955556555 3:60143925-60143947 GGGGTAGGGAGGCAAGCAGTAGG + Intronic
957135110 3:76277441-76277463 GGGATAGGAAGGCATTCTGCTGG + Intronic
957542345 3:81588701-81588723 GGGGTAAGGAAGCAATCATGAGG - Intronic
958455156 3:94321795-94321817 GGCATAAGGAGGCATTCTGCTGG + Intergenic
962301742 3:134250141-134250163 GGGCTAAGGAGGCAGTGAGGAGG + Intronic
963743678 3:149104607-149104629 GGGATAAGAAGGCATTCTGCTGG + Intergenic
966588075 3:181649850-181649872 GGAATAAGAAGGTATTCAGCTGG - Intergenic
967042108 3:185703424-185703446 AAAGTAAGGAGGCAATCAGCTGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968914419 4:3491059-3491081 GGGAGAAGGAAGGAATGAGCCGG - Intronic
968914456 4:3491206-3491228 GGGAGAAGGAAGGAATGAGCAGG - Intronic
970141510 4:12987416-12987438 GGGATAAGGAAGCAATCATGAGG + Intergenic
971419371 4:26461455-26461477 GGGATAATAAGGCAATCACAGGG - Intergenic
974117886 4:57603016-57603038 GGGAAAAGGAAACAAGCAGCAGG - Intergenic
974178062 4:58349597-58349619 GGGTTAAGGAGGCAATTCTCAGG - Intergenic
977459726 4:97310134-97310156 GGGATAAAGAGGTAGTCAGAGGG - Intronic
977574607 4:98662994-98663016 GGGGTGTGGAGGCAACCAGCAGG - Intergenic
977894694 4:102349875-102349897 AGGATAAGGAAGGAATCAGTGGG + Intronic
978329280 4:107594760-107594782 GGGATAAGGAGCCATTCTTCTGG - Intronic
978729612 4:112010167-112010189 GGGCTGAGGAGGCATTCTGCTGG + Intergenic
981172782 4:141644181-141644203 GAGATAAGGGGACAAGCAGCAGG - Intronic
981430780 4:144656966-144656988 GAGAAAAAGAGGCAAGCAGCTGG - Intronic
981922507 4:150100502-150100524 GGGATAAGTAGTAAGTCAGCTGG - Intronic
982162730 4:152586303-152586325 GGCAAAAGGAGGCAATAAGTAGG - Intergenic
983278468 4:165649274-165649296 GGGATGAGGAGGTATTCAGCTGG - Intergenic
983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG + Intergenic
984596258 4:181671689-181671711 GGGAAAAGTAGGCAATTAACTGG - Intergenic
986395909 5:7330333-7330355 GGGATGAGGAGGCATTCTGCTGG - Intergenic
987126079 5:14814016-14814038 GGGATAAGGTGGAAATTAGGAGG - Intronic
990171987 5:53061678-53061700 GGAAACAGGAAGCAATCAGCTGG - Intronic
991486032 5:67138225-67138247 GGGAAGAGGAGGCATTCTGCTGG + Intronic
994836531 5:104862021-104862043 GGGATGAGGAGGCATTCTGCTGG + Intergenic
994943975 5:106361433-106361455 GGGATGAGGAGGCATTCTGCTGG + Intergenic
996031118 5:118704743-118704765 GCTAGAAGGAGGCAATAAGCAGG + Intergenic
996552006 5:124740911-124740933 CAGATAGGGAGGCATTCAGCTGG - Intronic
997759960 5:136435846-136435868 GGAATGAGGAGGCATTCTGCTGG + Intergenic
998630685 5:143894951-143894973 GGGATGAGGAGGCATTCTGCTGG - Intergenic
1000181707 5:158817889-158817911 GGGATAAGGTGTCAATAAGGTGG - Intronic
1002309541 5:178306326-178306348 GGGCGAAGGGGGCAATCTGCTGG + Intronic
1002988967 6:2220177-2220199 GGGATAAGGAGGCGTTCTGCTGG - Intronic
1003263233 6:4543166-4543188 GGGATGAGGAGGAAAGCTGCTGG + Intergenic
1005283666 6:24301796-24301818 GGGATAAGGAGGCGAGAAGCTGG + Exonic
1006213793 6:32421021-32421043 GGGCTCAGGAGGGAATCTGCTGG + Intergenic
1006398164 6:33800520-33800542 GGGAAAAGGTGGAACTCAGCTGG - Intronic
1006509038 6:34511872-34511894 TGGATAAGGAGGCAAGGAGGGGG + Intronic
1009927231 6:70134841-70134863 GGAATTAGAAGACAATCAGCTGG - Intronic
1012997007 6:105984305-105984327 GGGAAAAGGAGGGGATCAGGTGG + Intergenic
1013190319 6:107798833-107798855 GGGTTAAGGAAGAAATCACCAGG - Intronic
1013291275 6:108720775-108720797 GGGATAAAAAGAGAATCAGCTGG - Intergenic
1013710694 6:112894149-112894171 GGGATGAGGAGGCATTCTGCTGG + Intergenic
1014908242 6:127057059-127057081 GGGATGAGGAGGCATTCTGCTGG + Intergenic
1016159331 6:140858469-140858491 GGGCTAAGAAGGCAAGGAGCTGG + Intergenic
1016449615 6:144168195-144168217 AGGATGAGGAGGCATTCTGCTGG + Intronic
1016527330 6:145016828-145016850 GGGGTAAGGAAGCAATCATAGGG + Intergenic
1017147655 6:151249116-151249138 GGGCTTAGGAGGCAATGAGATGG - Intronic
1020444483 7:8255047-8255069 GGGAGAAGGAAGCGAACAGCAGG - Intronic
1020628424 7:10611128-10611150 AGGAGATGGAGGGAATCAGCTGG + Intergenic
1024248451 7:47488475-47488497 GGGAGAAGGTGGCCATCTGCAGG - Intronic
1024670336 7:51588383-51588405 GGGGTAAGGAAGCAATCATGAGG - Intergenic
1026137064 7:67672840-67672862 GGGATAAGGAGGTAAAGAACAGG + Intergenic
1026176775 7:68005010-68005032 GGGGCAAGGAGGCAATCAGAGGG - Intergenic
1026998606 7:74635993-74636015 GGGGTAAGGAGGCAAAGAGAAGG - Intergenic
1028498234 7:91486740-91486762 GGGATGAGGAGGCATTCTGCTGG + Intergenic
1028830704 7:95324176-95324198 GGGATAAGGAGGCAATTGCCAGG - Intronic
1030257463 7:107526906-107526928 GGGATAATGAGGGAATCTGGAGG + Intronic
1032105269 7:129023606-129023628 AGGCAAAGGAGGCAACCAGCTGG + Intronic
1032513428 7:132490042-132490064 GGCATGTGCAGGCAATCAGCTGG + Intronic
1035120023 7:156559296-156559318 TGGATAAGAAGGCCATCACCTGG - Intergenic
1035121545 7:156572722-156572744 GGGAGAGGGTGGCAAACAGCTGG + Intergenic
1036187373 8:6635719-6635741 GGGACGAGGAGGCATTCTGCTGG - Intronic
1038479254 8:27890581-27890603 GGGATCCGGAGGCATTCAGAAGG - Intronic
1039805168 8:40991545-40991567 TGGAGGAGGAGGCCATCAGCTGG + Intergenic
1043385503 8:79744029-79744051 GGGTCAAGGAGCCAATCACCTGG - Intergenic
1043678318 8:82989574-82989596 GGGATAAGGAGGCATTTTGCTGG + Intergenic
1044626676 8:94240926-94240948 GGGATAAAGTGGCAATGAACAGG - Intergenic
1045094119 8:98779068-98779090 GGGATAAGGAAACATTCTGCTGG - Intronic
1045378597 8:101600493-101600515 GGAATAAGGAGGCACTAGGCAGG - Intronic
1046541480 8:115589256-115589278 GGTAAAGGAAGGCAATCAGCTGG + Intronic
1046668625 8:117033709-117033731 GGGAGAAGGATTCTATCAGCTGG + Intronic
1048327466 8:133450541-133450563 GGGAAAAGGAAGCTATCAGACGG + Intergenic
1048335678 8:133500446-133500468 GGGAAAAGGACGCAAAGAGCAGG - Intronic
1048964447 8:139605127-139605149 GGGAAAACGAGGCAGTTAGCAGG - Intronic
1049203696 8:141353693-141353715 AGGAGAAGGAAGCAAGCAGCCGG + Intergenic
1050105906 9:2166514-2166536 GGGATAAGAATACAATCAGTAGG - Intronic
1053483400 9:38433216-38433238 GGAATAAGGAGTCTATCAGGTGG + Intergenic
1057101740 9:92367506-92367528 GGGATAAGGAGGCATTCTGCTGG - Intronic
1058638161 9:107056868-107056890 GAGAAAAGGAGGGACTCAGCGGG - Intergenic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1188260065 X:28012683-28012705 GTGATGAGGAGGCATTCTGCTGG - Intergenic
1189758156 X:44293216-44293238 GAGATGAGGAGGCATTCTGCTGG + Intronic
1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG + Intergenic
1192250034 X:69404479-69404501 GGGTTAAGGAGGAAATTAACCGG - Intergenic
1194665990 X:96678211-96678233 GGCATAAGCAGGCAAACTGCTGG - Intergenic
1196732667 X:118956828-118956850 GGGGTAAGGAAGCAATCATGAGG + Intergenic
1197859063 X:130950132-130950154 GGGATAAGGAGGCAGGCTGATGG + Intergenic
1198619721 X:138492599-138492621 GGTATAAAGAGGGAAACAGCTGG + Intergenic
1199104635 X:143849708-143849730 GGGATGAGGAGGCATTCTGCTGG - Intergenic