ID: 922386172

View in Genome Browser
Species Human (GRCh38)
Location 1:225086084-225086106
Sequence ACACGTGGGGTTGCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922386172 Original CRISPR ACACGTGGGGTTGCTCAGTG AGG (reversed) Intronic
901194223 1:7431527-7431549 CCAAGTGGGGCTGCCCAGTGTGG - Intronic
901907279 1:12424536-12424558 ATGCGTGAGGCTGCTCAGTGAGG - Intronic
902978871 1:20109179-20109201 ACACTTGGGGTTCCTGACTGAGG - Intergenic
907829105 1:58047373-58047395 CCACGTGTGGTTGGACAGTGTGG + Intronic
912162413 1:107001699-107001721 ACACATGGGCTTGCTCACAGTGG - Intergenic
912933414 1:113983298-113983320 CCAGGTGGGGTGGCTCAGTCAGG + Intergenic
917575388 1:176316140-176316162 ACAGGTGGTTTTGCTCTGTGGGG - Intergenic
918566976 1:185945769-185945791 ACACATGGGCTTGCTAAGAGTGG + Intronic
922386172 1:225086084-225086106 ACACGTGGGGTTGCTCAGTGAGG - Intronic
922777217 1:228220552-228220574 ACACGTGGCTTTGCTGAGTTTGG + Intronic
923555827 1:234999766-234999788 AGAGGTGGGGCTGCTAAGTGGGG - Intergenic
1066049225 10:31619420-31619442 CAAAGTGGGTTTGCTCAGTGTGG + Intergenic
1067215903 10:44302556-44302578 ACATGTGGGGGTGCTCAGTCAGG + Intergenic
1067659316 10:48222511-48222533 ACCAGTGGGTTTTCTCAGTGTGG + Intronic
1069528292 10:69194163-69194185 ACAAGTGGAACTGCTCAGTGTGG + Intronic
1076783067 10:132735147-132735169 ACACGGGGGGTTGCAGAGGGTGG - Intronic
1081961553 11:47141386-47141408 ACACTTGGGGAGGCTAAGTGGGG + Intronic
1085044794 11:73346637-73346659 ACACGTGGCCTTGCACAGTTAGG - Intronic
1086107411 11:83160289-83160311 ACACGTGGGGTGGGTAAATGGGG + Intronic
1088745564 11:112801371-112801393 ACAGGTGGTGTTCCTCAGGGCGG + Intergenic
1089732318 11:120527031-120527053 ACAAGTGGGGAAACTCAGTGAGG + Intronic
1090414551 11:126531582-126531604 ATAGGTGGGGTTGCTTAGGGGGG - Intronic
1090597288 11:128333906-128333928 CCACATGGGGTTGGTCACTGAGG - Intergenic
1092119868 12:6036372-6036394 ACACTTGGTGAGGCTCAGTGAGG - Exonic
1094216366 12:27947054-27947076 ACACGTGGGTATGCTGAGGGAGG + Intergenic
1096596271 12:52697746-52697768 GCAGGTGGATTTGCTCAGTGCGG - Exonic
1096742014 12:53700493-53700515 AAACGTGGGGATGGTTAGTGGGG + Intergenic
1097242687 12:57586553-57586575 ACACAGGGGGTTGCGCAGTTTGG - Exonic
1101654547 12:106708479-106708501 AGAAATGGGGTTGCCCAGTGGGG + Intronic
1105027714 12:132860488-132860510 ACACGTGGGGTTGATCGGTGTGG - Intronic
1112197686 13:97241978-97242000 ACACATGGGGTTCCTCCGAGAGG + Intronic
1114204505 14:20556050-20556072 TGACGTGGGGTTTCTCAGTTTGG - Intergenic
1122017036 14:98804994-98805016 AAATGAGGGGTTGTTCAGTGGGG + Intergenic
1131881989 15:96871687-96871709 ACAAGTGGGGTTGATCTGTCAGG + Intergenic
1132407337 15:101551841-101551863 CCGCGTGGGGCTGCTCTGTGAGG - Intergenic
1135114700 16:19714699-19714721 CCACTTGGAGTTCCTCAGTGGGG - Exonic
1141080635 16:81048466-81048488 ACAGGAAGTGTTGCTCAGTGGGG + Intergenic
1142121860 16:88390405-88390427 CCACGTGGGGTTACGCAGTCTGG - Intergenic
1142261565 16:89044893-89044915 CAACGTGGGGTTCCGCAGTGGGG - Intergenic
1146984503 17:37202110-37202132 AAAGGAGGGGTTTCTCAGTGTGG + Intronic
1148342678 17:46882943-46882965 ACCCCTGGGGTTGCCCAGAGGGG - Intronic
1153679474 18:7486585-7486607 GCACGTGGGGTTTCTGAGAGGGG + Intergenic
1160135400 18:76267025-76267047 AGAAGTGTGGGTGCTCAGTGAGG - Intergenic
1160367175 18:78336232-78336254 ACACATGGGTTTTCTCTGTGAGG - Intergenic
1162599527 19:11657263-11657285 ATACGTGGGATTGGTCAGAGTGG + Intergenic
1162628410 19:11905024-11905046 ACACGTGGTAATGCACAGTGGGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
933691911 2:85185411-85185433 AGACGTGATGTTGCTGAGTGTGG - Intronic
934971985 2:98771179-98771201 ACAGGTGGGGCGGCTCAGTCGGG - Intergenic
936786394 2:116098610-116098632 ACACCTGGGCATGCTCTGTGTGG + Intergenic
942822543 2:180132911-180132933 ACATGTGGGAGAGCTCAGTGAGG + Intergenic
945072675 2:206006859-206006881 AGAGGTGGGGTTTCGCAGTGTGG - Intronic
948686996 2:239675965-239675987 AGATGTGGGTTTGCTGAGTGAGG + Intergenic
948813689 2:240499098-240499120 ACCTGGGGTGTTGCTCAGTGGGG + Intronic
1170381044 20:15760060-15760082 TCACGTGGGGTTGATCTTTGTGG - Intronic
1172199980 20:33118635-33118657 ACTGGTGGAGATGCTCAGTGAGG - Intergenic
1172205963 20:33163074-33163096 ACATGTGGGGGTGCTCTGTGGGG + Intronic
1173664279 20:44753853-44753875 ACACCTGGGGGTGGTCAGTGAGG - Intronic
1174304046 20:49602698-49602720 ACCTGTGGGGTTGCTCAGCACGG - Intergenic
1175465112 20:59185530-59185552 ACCCGAGGGGTGTCTCAGTGGGG - Intergenic
1178162013 21:29928720-29928742 CCACATGGGGCTGCTCAGTCAGG + Intronic
1182076778 22:27500262-27500284 GCACGAGGAGCTGCTCAGTGGGG - Intergenic
950426729 3:12928363-12928385 AGAAGTGAGGATGCTCAGTGAGG + Intronic
952041403 3:29266311-29266333 AAACGTGGAGTTGGTCAGTAGGG + Intergenic
959041193 3:101424578-101424600 GCAGGGGTGGTTGCTCAGTGTGG - Intronic
964201825 3:154125980-154126002 ACACATGAGGTGGCTCAGTGAGG - Intronic
966969512 3:185030357-185030379 AAACCAGGGGTTGCTCAGAGAGG - Intronic
968438053 4:605396-605418 ACAGGTGGGCTTGCTCAACGCGG - Intergenic
968976657 4:3825610-3825632 CCACGTGGGGTTGCTCTGACTGG + Intergenic
969181691 4:5446801-5446823 ACACGAGGGGCTGTGCAGTGGGG + Intronic
969652062 4:8473879-8473901 ACACGGGGAGTGGGTCAGTGAGG + Intronic
986497535 5:8360673-8360695 ACACGTGGGCATGCTCTGCGTGG + Intergenic
991113946 5:62931718-62931740 ACACCTGGGCATGCTCAGAGAGG - Intergenic
991914542 5:71592787-71592809 ACAGATGGGGTGGCCCAGTGTGG + Intronic
994206635 5:97043248-97043270 ACCTGTGTGGTTACTCAGTGCGG - Intergenic
997296044 5:132769093-132769115 ACACATGGTGGTCCTCAGTGAGG - Intronic
1000294409 5:159900709-159900731 CCAGCTGGGCTTGCTCAGTGGGG - Intergenic
1001597304 5:172906508-172906530 ACACCTGGGGCTTCTCTGTGGGG - Intronic
1003980235 6:11382300-11382322 ACGTGTGTGGTTGCTCAGTAGGG - Intronic
1006103868 6:31704121-31704143 ACACTTGGGGTGGCTGAGAGAGG + Intronic
1007842115 6:44725125-44725147 AGAAGTGGGGATGCGCAGTGAGG + Intergenic
1011553583 6:88551323-88551345 ACCAGTGGAGTTGTTCAGTGTGG - Intergenic
1016363343 6:143291024-143291046 ACACTTGGCTTTGGTCAGTGTGG - Intronic
1022470819 7:30681116-30681138 CCAGGTGGGGTCGTTCAGTGTGG - Intronic
1026988444 7:74569452-74569474 CCAGGTGGGGTTGTGCAGTGAGG + Intronic
1033289905 7:140074896-140074918 ACACGTGTGTTTTCTCTGTGAGG + Intergenic
1033653656 7:143360011-143360033 AGACTTGGGGTGGCTGAGTGAGG + Intronic
1035000220 7:155606659-155606681 ACACGTGAGATTACTCACTGCGG + Intergenic
1035355824 7:158275723-158275745 ACACGTGGAGGTGCGCAGGGTGG - Intronic
1035361540 7:158316763-158316785 GCCCGTGCGGTCGCTCAGTGCGG + Intronic
1037646689 8:20798964-20798986 AGAGGTGGTGTTGCTCACTGGGG - Intergenic
1040508783 8:48075306-48075328 AGACGTGGGGTTGGACAGAGGGG + Intergenic
1054736918 9:68762860-68762882 ACACGTGGAGTTGTACAGTATGG - Intronic
1059402234 9:114077638-114077660 ACACCTGGGGTGGCACAGCGTGG - Intronic
1059408522 9:114117451-114117473 ACCTGTGGGTGTGCTCAGTGAGG + Intergenic
1061203972 9:129152551-129152573 ACACCAGGGGTTGCCCAGTGGGG - Intergenic
1189148211 X:38676898-38676920 ACACGTATGGGTACTCAGTGGGG - Intronic
1193978205 X:88149822-88149844 ACCCATGGCTTTGCTCAGTGAGG + Intergenic
1195598780 X:106722840-106722862 ATAAGTAGGGTTGCTCGGTGAGG + Intronic
1200064989 X:153499949-153499971 TCAGGTCGGGTTGCTCAGGGGGG + Intronic
1201666170 Y:16458520-16458542 ACACATGGGTTTCCTCAGTGAGG - Intergenic