ID: 922388659

View in Genome Browser
Species Human (GRCh38)
Location 1:225114776-225114798
Sequence AGAGAGAGCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 2, 1: 18, 2: 77, 3: 163, 4: 489}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922388659_922388668 27 Left 922388659 1:225114776-225114798 CCCACAGTCACTGTGCTCTCTCT 0: 2
1: 18
2: 77
3: 163
4: 489
Right 922388668 1:225114826-225114848 TGCCACAAGTCCACCACAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 107
922388659_922388665 24 Left 922388659 1:225114776-225114798 CCCACAGTCACTGTGCTCTCTCT 0: 2
1: 18
2: 77
3: 163
4: 489
Right 922388665 1:225114823-225114845 CTGTGCCACAAGTCCACCACAGG 0: 1
1: 0
2: 0
3: 8
4: 121
922388659_922388667 26 Left 922388659 1:225114776-225114798 CCCACAGTCACTGTGCTCTCTCT 0: 2
1: 18
2: 77
3: 163
4: 489
Right 922388667 1:225114825-225114847 GTGCCACAAGTCCACCACAGGGG 0: 1
1: 0
2: 1
3: 6
4: 90
922388659_922388670 30 Left 922388659 1:225114776-225114798 CCCACAGTCACTGTGCTCTCTCT 0: 2
1: 18
2: 77
3: 163
4: 489
Right 922388670 1:225114829-225114851 CACAAGTCCACCACAGGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 121
922388659_922388666 25 Left 922388659 1:225114776-225114798 CCCACAGTCACTGTGCTCTCTCT 0: 2
1: 18
2: 77
3: 163
4: 489
Right 922388666 1:225114824-225114846 TGTGCCACAAGTCCACCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922388659 Original CRISPR AGAGAGAGCACAGTGACTGT GGG (reversed) Intronic
900654081 1:3746653-3746675 TGATTGAGCACAGTGACTCTGGG - Intergenic
901829801 1:11885518-11885540 AGAGATGGCTCAGTGCCTGTGGG - Intergenic
902245750 1:15119350-15119372 AGACAGACCACAGTGACACTTGG - Intergenic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
905622882 1:39464079-39464101 AGAGCAGGCACAGTGTCTGTTGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907263019 1:53236239-53236261 AGAGACAGCACAGAGGCTGTTGG - Intronic
907263954 1:53243669-53243691 TGAAAGAGCACAGGGACTTTAGG - Intergenic
907842448 1:58170775-58170797 CCAGAGAGCACAGTGTCTCTGGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910044860 1:82901172-82901194 AGAGAGAGCATAGTGTTGGTAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
913147670 1:116008103-116008125 ACAGTTAGCACAGTGACCGTGGG + Intronic
914698333 1:150106815-150106837 AAACAGAAGACAGTGACTGTGGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915627693 1:157125630-157125652 AGAGACAGCGAAGGGACTGTGGG + Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917037527 1:170765387-170765409 AGAAGGAGCACATTGACTCTTGG - Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917970978 1:180207517-180207539 AGAGAGAGGACAGAGAATATAGG + Intergenic
918238713 1:182603603-182603625 AGAGAGATCAGTGTGACTTTAGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919648652 1:200123371-200123393 AGAGAGAGCAAAATGAGTTTGGG + Intronic
919743198 1:200992695-200992717 AGACACAGGACAGTGGCTGTGGG - Intronic
919779848 1:201214677-201214699 AGAGACATCACAGTGACTCAGGG + Intronic
920031513 1:203040199-203040221 ACAGTGCTCACAGTGACTGTGGG + Intronic
920377609 1:205517589-205517611 AGAGATAGAACAGTCACTGGAGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920671692 1:208008584-208008606 AGAGAGATGAGAGTGACAGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921264753 1:213412889-213412911 AGAAAGAGCACTGTGGCTGGGGG - Intergenic
921316122 1:213892881-213892903 AGAGAGGGCACTGTAAATGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063781690 10:9332175-9332197 AGAGAAAGAAAATTGACTGTTGG - Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1066400312 10:35069610-35069632 AGAGAAATAACAGTGACTGAAGG + Intronic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067406061 10:46024420-46024442 AGAGAGAGAACAGAGACCGTTGG - Intronic
1067990180 10:51203104-51203126 AGAGAGAGAACAGTGTCTCAAGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069111713 10:64455597-64455619 AGAGAGAGCATATTGAGTATTGG + Intergenic
1070789168 10:79179566-79179588 AGAGAGAGCTGAGTGGCTGCAGG + Intronic
1071103074 10:82061645-82061667 AGAGTGAGCTCAGTGAATGCTGG + Intronic
1071295327 10:84215171-84215193 ACAGAAAACACACTGACTGTGGG + Exonic
1071457834 10:85864327-85864349 AGAGAGGGCACAGTGGATGCAGG + Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072897203 10:99377106-99377128 ACCGAGAGCGCAGTGACTTTGGG + Exonic
1073042669 10:100618077-100618099 AGAGAGAGGACAGTGCCTTGAGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1073989722 10:109248737-109248759 AGAGCCAGCACATTGACTTTAGG - Intergenic
1074057367 10:109934795-109934817 AGACAGAGCACAATAAATGTTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075677450 10:124305282-124305304 AGCTAGAGCACAGTGACTCAAGG + Intergenic
1076864127 10:133159119-133159141 AGAGAGAGCTCAGGGACAGCTGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1077954085 11:6994641-6994663 AGTGACAGCACAGTGGCTGAAGG - Intergenic
1078018150 11:7632955-7632977 CCTGAGAGCACAGTGGCTGTGGG - Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079150438 11:17894222-17894244 AGTGAGAGCACAGTGTAAGTTGG - Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080113085 11:28591717-28591739 AGAGAATGTACAGTGAGTGTAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1084243732 11:67841183-67841205 AGAGAGAGCCCATTCTCTGTTGG - Intergenic
1084828956 11:71753389-71753411 AGAGAGAGCCCATTCTCTGTTGG + Intergenic
1085379803 11:76105136-76105158 AGATAGATCACAGAAACTGTGGG + Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091348692 11:134874970-134874992 AGAGAGGGCAAAGCCACTGTGGG - Intergenic
1091657840 12:2358804-2358826 CCAGTGAGGACAGTGACTGTAGG - Intronic
1092112099 12:5971117-5971139 AGAAATAGCAGAGGGACTGTGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095618852 12:44224926-44224948 AGAGAGACCACAGTAACTCCAGG + Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096368540 12:51048792-51048814 GGAGAGAGCGCAATGCCTGTGGG - Intronic
1096966793 12:55634755-55634777 TGAGAGAGCAGAGTGAGGGTGGG + Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099424005 12:82500736-82500758 AGAAAAATCACACTGACTGTTGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099636693 12:85222656-85222678 AGAGAGAGAAGAGTCACTGGAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101010156 12:100441149-100441171 AGAGAGAGCACAGAGAAGGTAGG - Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1101814775 12:108137483-108137505 AGAGAGTGCACAGTGACAGCAGG + Intronic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103171405 12:118823266-118823288 AGTGTGAGCACAGGGACTGATGG + Intergenic
1103246466 12:119462146-119462168 AGAGACAGGGCAGTCACTGTTGG - Intronic
1103657773 12:122487163-122487185 AGAGAAAGCAGAGTAGCTGTGGG - Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107089880 13:36467103-36467125 AGAGATTGCACTGAGACTGTAGG + Intergenic
1107282071 13:38748181-38748203 AGACAGACCACATTTACTGTTGG - Intronic
1107417315 13:40212583-40212605 AGAGTAAGCACAGAGTCTGTCGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113079537 13:106503703-106503725 AGAGAGAGTCCAGTGGCAGTGGG - Intronic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115485964 14:33911592-33911614 AGAGAGAGTCCAGTGGCAGTGGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116072066 14:40059670-40059692 TGAGTCAGCACAGTGAGTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118509348 14:66453939-66453961 AGAGAGAACAGGGTGACTGGAGG + Intergenic
1118616514 14:67577881-67577903 AGAGGGAGCACTGCTACTGTTGG - Intronic
1118747995 14:68787542-68787564 AGAGAGAGGGCTGTGGCTGTGGG - Intergenic
1119027234 14:71163896-71163918 AGAGAGATCACAGTCTATGTGGG - Intergenic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120550401 14:85864394-85864416 AGCCAGACCACAGTGAATGTTGG + Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121092623 14:91193316-91193338 AGAGAGGGCAGAGTGACTTCTGG - Intronic
1121544955 14:94756371-94756393 AGAAAGAGCAGAGTGTCTGGTGG + Intergenic
1121740568 14:96249202-96249224 AGACAGAGCACGGTGTGTGTGGG + Intronic
1122195906 14:100085693-100085715 AGAGAGAGAACAGAAACTCTGGG + Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126146379 15:45476633-45476655 ACAGTGATCACAGTGAATGTTGG - Intergenic
1126315631 15:47366267-47366289 AGAGAGTGCACTGTGACTTCAGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127550972 15:60038076-60038098 AAAGAGACCAAAGAGACTGTGGG + Intronic
1127632685 15:60841409-60841431 AGAGAGAGCCCATTGCCAGTAGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129264731 15:74387549-74387571 AGAGAGAGCACATGGACCGGCGG + Intergenic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132723117 16:1326559-1326581 ACCGAGAGCTCAGTGACTGCAGG - Exonic
1133485806 16:6217384-6217406 TGAGAGATCACTGAGACTGTAGG - Intronic
1133685051 16:8158624-8158646 TGAGAGAGAACACTGACTCTGGG - Intergenic
1133713068 16:8420095-8420117 AGAGAGAGAATAATGACTGGAGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136414503 16:30095419-30095441 AGAGGGAGCCCAGTGCCTGCCGG + Exonic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137730698 16:50687486-50687508 GGAGAGCCCACAGGGACTGTGGG + Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139549021 16:67663339-67663361 ACAGTGAGAACAGTGAGTGTTGG + Intronic
1141137216 16:81474220-81474242 GGAGAGGGCAAGGTGACTGTGGG + Intronic
1142061852 16:88035552-88035574 AGAGAGGCCACAGAGACTGCAGG - Intronic
1142132283 16:88436541-88436563 AGAGAGAACGCTGTGACGGTGGG + Exonic
1142682328 17:1557426-1557448 AGACGGAGCCCAGTGACTGGAGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144484094 17:15650852-15650874 AGAGATCGCACAGAGACAGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145231675 17:21177687-21177709 AGAGGGAGCAGAGTGCCTGAAGG - Intronic
1145296669 17:21598407-21598429 AGTGAGGGGACAGTGGCTGTTGG - Intergenic
1145367110 17:22273671-22273693 AGTGAGGGGACAGTGGCTGTTGG + Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149332596 17:55601997-55602019 AGAGAGAGCTCAGTGGCTTGTGG - Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150138850 17:62712063-62712085 AGAGTGAGCACAGCCACTCTTGG - Intronic
1150202077 17:63368062-63368084 ATAGAGAGCAGAGTGTATGTGGG + Intronic
1150202286 17:63369988-63370010 AGAGAGAGCAGGGTGTATGTGGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1152891602 17:82884718-82884740 AGAGAGAGCCCTGTGACGTTTGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155195958 18:23474769-23474791 ATAGAGAGCTCAGGGACTGATGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157372523 18:47129371-47129393 AGAGAGACATCAGTGGCTGTGGG - Intronic
1158025099 18:52886464-52886486 ACAGACAGCACAGCGACTGGGGG - Intronic
1158138560 18:54232175-54232197 AGAGAAGCAACAGTGACTGTGGG + Intergenic
1158593983 18:58800678-58800700 AGAGAGAGCACAGGGTATTTAGG + Intergenic
1158648922 18:59269507-59269529 GGAGAGAGCACAGGGGCCGTCGG + Intronic
1159280583 18:66279636-66279658 AGACAGAGCACAGAACCTGTTGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159542861 18:69801737-69801759 AGAGAAAGAACAGTAACTTTTGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159829895 18:73263703-73263725 ACAGAGAAAACAGTGACAGTTGG - Intronic
1160006274 18:75071427-75071449 AGAGAGAGCTCTTTGACTATAGG + Intergenic
1160597011 18:79982720-79982742 AGAGAGAGGGAAGTTACTGTGGG + Intronic
1161785016 19:6319214-6319236 AGAAGGAGGACAGAGACTGTGGG + Intronic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1164374450 19:27673114-27673136 AGAGACAGCTGAGCGACTGTAGG - Intergenic
1164823553 19:31267859-31267881 GGAGAGAGCAGAGTGAAGGTTGG + Intergenic
1164869372 19:31630437-31630459 AGTGAGAGCACAGAGCCTCTCGG + Intergenic
1166068969 19:40376871-40376893 AGAGTGAGCCCTGTCACTGTGGG + Intronic
1167613111 19:50516860-50516882 AGAGAAAACAAAGTGAATGTGGG - Intergenic
1168553451 19:57318815-57318837 AGAGAGTGCACTGTGGCTGGGGG + Intergenic
1168709719 19:58492026-58492048 AGAGAGACCCTAGTCACTGTGGG + Intronic
924974805 2:162766-162788 AGAGGGAGCAGAGGGTCTGTGGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926445667 2:12938861-12938883 AGAGGGAGGACAATGCCTGTTGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926553875 2:14333598-14333620 ACAGAGAAGACAGAGACTGTAGG - Intergenic
927521478 2:23701360-23701382 AGAGAGATCACTGTGTCTGCAGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930068603 2:47347240-47347262 AGTGAGACCACAGAGACTTTAGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930475350 2:51875149-51875171 AGAGAGGACACAGTGGCTGGGGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931129511 2:59318420-59318442 AGAGAGAGAACAGAGACAGAAGG + Intergenic
932124591 2:69132282-69132304 ATAGAGGCCACAGTGACTGCAGG + Intronic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932291980 2:70589537-70589559 AGAGAGAACACATTGACGATGGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933986414 2:87595637-87595659 TGAGAGGGCCCAGTGTCTGTGGG + Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
934607736 2:95710270-95710292 GGAGAGAGCACACTGACTGAGGG + Intergenic
934774173 2:96926832-96926854 AGAGACAGCCCAGTTACGGTGGG + Intronic
935655754 2:105421181-105421203 AGAGAGAACCCAGTGACGATGGG - Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936307423 2:111355164-111355186 TGAGAGGGCCCAGTGTCTGTGGG - Intergenic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936541077 2:113352150-113352172 GGAGAGAGCACACTGACTGAGGG + Intergenic
936542542 2:113363899-113363921 AGAGAGAGCACACAGTCTGTCGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939238310 2:139526072-139526094 AGAGAGAGAAGAGTGAGTGAAGG + Intergenic
939736850 2:145857773-145857795 TGAGAGAGTAGAGTCACTGTTGG - Intergenic
940015678 2:149101624-149101646 GGAGAGAGGACGGTGCCTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940905036 2:159161234-159161256 AGGGAGAGCACTTTGACTTTTGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941580870 2:167293876-167293898 AGAGAGGGAAAAGTAACTGTTGG + Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944436439 2:199695523-199695545 GGAGAGAGGACAGAGACTCTGGG + Intergenic
944613989 2:201441661-201441683 AGAAAGAGCACACTGTCTGGAGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945399994 2:209369944-209369966 AGAGAGAGCAAAATGAGTTTAGG + Intergenic
947027403 2:225751960-225751982 AGAAAGACAACAGAGACTGTAGG - Intergenic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947989923 2:234478717-234478739 AGACTGAGCACAGTGACTCTAGG + Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948677890 2:239609777-239609799 AGAGAGGGCACACTGCCTGCCGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169646773 20:7819866-7819888 AGAGAGAGAATAATGACAGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170334955 20:15259438-15259460 AGATATAGCACTGTGACTGGGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171248089 20:23629363-23629385 AGAGAAGGCACAGAGCCTGTGGG + Exonic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172221273 20:33276687-33276709 AGAGAGAGGAGAGAGACAGTGGG + Intronic
1172327838 20:34050806-34050828 AGAGATAGCATACTGGCTGTGGG - Intronic
1173142440 20:40495901-40495923 AGAAGGAGCCCAGTGCCTGTTGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174451587 20:50624175-50624197 AGAGGGAGCACAGCCCCTGTGGG - Intronic
1174774553 20:53331910-53331932 AGAGAAGGGACAGTGACTCTCGG + Intronic
1175067057 20:56298036-56298058 GGAGAGAGCAGGGTGACTGGTGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1179050953 21:37888227-37888249 AGAGAGAGGAAAGTGTCTGAGGG - Intronic
1179215200 21:39361515-39361537 AGACAGAGCACAGAGACTTTTGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180741708 22:18057626-18057648 ATAGAGACCAAAGTGACTATGGG + Intergenic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1183034094 22:35127648-35127670 AGTGAGAGCTTAGTGCCTGTGGG - Intergenic
1184605060 22:45568079-45568101 AAAGAGACCATAGAGACTGTGGG + Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950543774 3:13627106-13627128 AGAGATGGCAGAGTGACTGGGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
952955028 3:38551543-38551565 TCCGAGAGCACAGTGCCTGTGGG + Exonic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954688868 3:52385271-52385293 AGAGAGAGCACAGGGCCTGCTGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956953569 3:74310976-74310998 GGAGAGAGGACAGTGAGTTTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958537247 3:95419010-95419032 AGAGAGAGGACAGGGACCCTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959215659 3:103447625-103447647 AAAGAGAGCACCGTAACTGGAGG + Intergenic
959756533 3:109906135-109906157 AGACAAAGCACAGTGACCCTGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960270330 3:115666960-115666982 AGAGAGAGGAAAATGACTGCTGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963547431 3:146677649-146677671 AAAGAGAACACAGGGACTGAGGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964494919 3:157278405-157278427 AAAGAGAGCAGAGGGAATGTGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964656271 3:159069337-159069359 ACAGAGCGCAATGTGACTGTGGG - Exonic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966824323 3:183951320-183951342 CCTGAGAGCACAGTGACTGCTGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968017908 3:195356193-195356215 GGAAAGAGCACAGCAACTGTGGG + Intronic
968124990 3:196152342-196152364 AGACAGACCTCAGTGACTTTGGG + Intergenic
969544331 4:7814771-7814793 AGAAAGAGCACAGGGGCTGGGGG + Intronic
969671012 4:8590410-8590432 AGAGAGAGGACTGTCACTCTGGG - Intronic
969810707 4:9645461-9645483 AGAGAGAGCCCATTCTCTGTTGG + Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970617551 4:17781790-17781812 GGACAGGGCACAGTGACTGGCGG + Intergenic
970617560 4:17781824-17781846 GGACAGGGCACAGTGACTGGCGG + Intergenic
971750426 4:30640063-30640085 AGAAAGTGCCCATTGACTGTAGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972686735 4:41360103-41360125 AGTAGGTGCACAGTGACTGTTGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974148787 4:57979153-57979175 TGAGTGAGCTCAGTGACTTTAGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978926045 4:114246095-114246117 AGAGAGAGAATGGGGACTGTTGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982053050 4:151522514-151522536 GGAGAGAGGACAGTCACTGCTGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985545084 5:505322-505344 GGAGAGGGGAGAGTGACTGTAGG + Intronic
985545133 5:505482-505504 ACAGAGGGGAGAGTGACTGTGGG + Intronic
985545188 5:505641-505663 ACAGAGGGGAGAGTGACTGTGGG + Intronic
985545217 5:505722-505744 GGAGAGGGGAGAGTGACTGTGGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986091491 5:4512561-4512583 AGCGACAGGACAGAGACTGTAGG - Intergenic
986953566 5:13121990-13122012 AAAAAGAGCACAGTGTCTGAGGG - Intergenic
986986978 5:13511507-13511529 AGAGAGACGACTGTGAATGTAGG + Intergenic
987383996 5:17311944-17311966 AAATCGAGCACAGTGCCTGTGGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
988709525 5:33759545-33759567 AGAGACAGCAGATTGACTGAAGG - Intronic
989432794 5:41375184-41375206 AGAGAGAGCCCAGAGAAAGTAGG + Intronic
990036458 5:51326797-51326819 AGAGAGAGCACTGTGACTCACGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991514264 5:67416439-67416461 AAAAAGACCACAGTGACTATAGG + Intergenic
992213851 5:74506696-74506718 AGATAGAGCACAGGCACTGGAGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992978742 5:82143426-82143448 AAAGTGAGAACAGTGTCTGTGGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993535084 5:89074235-89074257 AGATAAAGTACAGTGACTGGAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993940739 5:94055423-94055445 AGAGAGAGGCTAGTGACTGAAGG - Intronic
994082572 5:95723791-95723813 AGAGACAGCACAGTGAAGCTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
996210945 5:120808926-120808948 AGAGAGGGGACAGTCACTGGAGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997353821 5:133249516-133249538 AGTGTGACCACAGTGACCGTGGG - Exonic
997389651 5:133503736-133503758 GGAGAGAGCACATAGGCTGTTGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997840373 5:137234192-137234214 AGAGAGGCCACAGTGTCTGGGGG - Intronic
998098768 5:139414478-139414500 TAAGAGAGCACAGATACTGTTGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999085289 5:148883054-148883076 AGAGAGAGCAGGGTGAGTGGAGG - Intergenic
999268052 5:150279771-150279793 GGAGAGGGCACAGTGACAGTGGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001281941 5:170392289-170392311 AGAGAGAGCACAGAGCAGGTGGG - Intronic
1001495837 5:172187472-172187494 AGAGAGACCACAGATGCTGTGGG - Intronic
1002332999 5:178457968-178457990 ATAGAGACCACAGTGAATATGGG - Intronic
1002800991 6:521336-521358 CGAGTGTGGACAGTGACTGTCGG - Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1003241953 6:4352773-4352795 AGAGAGAGGAGTGGGACTGTAGG + Intergenic
1003566194 6:7224578-7224600 ACAGAGAGGACAGTGACCCTTGG - Intronic
1004804442 6:19187468-19187490 AGAGATAGCACAGTAACCGAGGG - Intergenic
1005089843 6:22044876-22044898 AGTGAGAGCACCAAGACTGTGGG + Intergenic
1005810336 6:29510382-29510404 AGAGAGAGCACATTGTCTGCAGG + Intergenic
1006520669 6:34569173-34569195 AGAGGGAGGACAGAGACTGCGGG + Intergenic
1007230997 6:40347729-40347751 AGAGGGAACACAGTGACACTAGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009327905 6:62376728-62376750 ACAGAAAGCACACTGGCTGTGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010094262 6:72021578-72021600 AGAAAGAACACAGTGTCAGTTGG + Intronic
1010559181 6:77326682-77326704 AGACAGGGCTTAGTGACTGTTGG + Intergenic
1012807207 6:103909168-103909190 AAAGAGAGCACAGCAACTGAAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015201617 6:130588018-130588040 AGAGAGAAAACTGTGACTTTGGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016214926 6:141588088-141588110 TGAGTGAGTACAGGGACTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018219593 6:161565039-161565061 AGAGAGAGGACAGGGAAAGTTGG - Intronic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020470722 7:8531507-8531529 ATAGAGAGTACAGTAACTGAAGG - Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021697388 7:23287885-23287907 AGAGAGAGCCCCGAGACTGGAGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023267626 7:38424195-38424217 AGATAGAGTTCATTGACTGTGGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024945193 7:54800916-54800938 AGAAATGGCACAGTGAGTGTGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025005229 7:55348824-55348846 AGACAGAGCTCAGTGACTCCAGG + Intergenic
1026771755 7:73206299-73206321 TTAAAGAGCAGAGTGACTGTGGG + Intergenic
1027012623 7:74759695-74759717 TTAAAGAGCAGAGTGACTGTGGG + Intronic
1027075417 7:75186358-75186380 TTAAAGAGCAGAGTGACTGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027526263 7:79272971-79272993 AGAGAGACCAAAATTACTGTAGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029741328 7:102493310-102493332 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029759318 7:102592479-102592501 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029776687 7:102688389-102688411 ATAGAGAGCCCAGTGAATGAGGG + Intergenic
1030327015 7:108230363-108230385 AGAGAGAGTAGAGAGACTGTTGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033229229 7:139583696-139583718 AGAAAGTGCCCAGTGACTGCAGG - Intronic
1033236027 7:139638373-139638395 AGAGCCAGCACAGAGACAGTGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033973381 7:147070328-147070350 AGAAAAAGCACATTGCCTGTCGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034257296 7:149731645-149731667 AGAAAGAGCACAGAGACCTTGGG - Intronic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034821712 7:154222251-154222273 AGAGAAAGCACAGAGGCGGTGGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035025670 7:155823823-155823845 AGACATGGCTCAGTGACTGTAGG - Intergenic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1037177313 8:15962240-15962262 AGAGGGAGGACAGAGACCGTAGG - Intergenic
1037587393 8:20287599-20287621 AGAGAGAGAAGAGTGAGTGAAGG + Intronic
1037753681 8:21698217-21698239 GGAGGCAGCACAGGGACTGTGGG + Intronic
1037892088 8:22628851-22628873 AGAAAGAGCTCCGTGGCTGTGGG - Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039511814 8:38097974-38097996 AGAGAGAGCAGAGGGACAGGAGG - Intergenic
1040336695 8:46419664-46419686 AGAGAGACCACAGGGAATGCTGG + Intergenic
1040336735 8:46419881-46419903 AGCGAGACCACACTGAATGTTGG + Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041500719 8:58535405-58535427 AGAGAGAGTCCAGTGGCGGTGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042656164 8:71099339-71099361 AGAGAGAGCACAATTTCTGATGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045559646 8:103248671-103248693 AGAGAGAGCCCAGTGGCGGTGGG + Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046557192 8:115789941-115789963 AGAGATGGCACAGTGGCTGTGGG + Intronic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048043731 8:130754224-130754246 AGAGAGAGGACATGGACTGGGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048830484 8:138472127-138472149 AGAGAGAGGACAGAGACAGGAGG + Intronic
1048974537 8:139663577-139663599 AGAGAGACCACAGAGACAGAGGG + Intronic
1049725694 8:144144774-144144796 CTAGACAGCACAGTGGCTGTGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051376142 9:16404829-16404851 GAAGTGAGCACAGTGACAGTAGG - Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051725966 9:20088637-20088659 GGAGAGTCCACAGTGACTGGAGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052549348 9:29928313-29928335 AGAGAGAGCATAGAGACAGCAGG + Intergenic
1053487045 9:38466885-38466907 AGAGAGAGAACAGTAAGGGTTGG - Intergenic
1053499321 9:38571008-38571030 AGACACAGCACAGAGACTGCAGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056388722 9:86120584-86120606 ACAGAGCACACAGTGACTGCTGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056775728 9:89511192-89511214 AGAGAGAGCTAAGTGCCTGGAGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060658219 9:125387531-125387553 ATAAAGGGCACAGGGACTGTGGG - Intergenic
1061164887 9:128916520-128916542 AGCGAGAGGACAGTATCTGTGGG + Exonic
1061284516 9:129614461-129614483 AGCTAGAGGACATTGACTGTTGG + Intronic
1061495590 9:130972520-130972542 AGACAGAGCACAGAGACAGAGGG - Intergenic
1061495594 9:130972578-130972600 AGACAGAGCACAGAGACAGAGGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061839822 9:133352124-133352146 ACAGAGAGCACAGTCCCTGGAGG - Exonic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185635567 X:1549346-1549368 ACACAGAGCCCAGTAACTGTCGG - Intergenic
1186326864 X:8487675-8487697 AGATAGAGCAAAGCCACTGTGGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186481616 X:9900706-9900728 AGATAGAGCAAAGTGACTTCTGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187149214 X:16666727-16666749 TGACAGAGCACAGTGGCTTTGGG + Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188027501 X:25226096-25226118 GGAGAGACCACTGTGACTGGGGG + Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188112792 X:26212034-26212056 GGAGAGAACGCAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974544 X:36657455-36657477 ACAGAGAGCAAAGAGACTGGAGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189262409 X:39688166-39688188 AGAGAGAAGACAGTGTCTGGGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189666630 X:43362095-43362117 TGAGAGAGGACAGAGAATGTTGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191033811 X:56004587-56004609 AGCCAGCTCACAGTGACTGTAGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194257614 X:91653493-91653515 AGAGAGAACACAATGACCGGAGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195917111 X:109947089-109947111 AAAGAAAGAACACTGACTGTGGG + Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197411412 X:126120706-126120728 AGAGAGAGAAGAGAGACTCTAGG - Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197709873 X:129658064-129658086 GGAGAGGGCAAAGTCACTGTGGG - Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199639700 X:149848167-149848189 AGAGGGATCACAGTCTCTGTGGG + Intergenic
1199643665 X:149884979-149885001 GGAGGGAGCACAGTGTCTATTGG + Exonic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199893930 X:152114820-152114842 GGAGGGAGCACAGTGTCTGTGGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200018577 X:153183066-153183088 GGAGGGAGCACAGTGCCTATGGG + Exonic
1200098289 X:153674229-153674251 AGAGGGAGCCCAGTGAGTGCCGG - Exonic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic
1202080636 Y:21080624-21080646 TGAGAAAACACAGTGACAGTAGG + Intergenic