ID: 922391794

View in Genome Browser
Species Human (GRCh38)
Location 1:225151317-225151339
Sequence CTGTGGATATAGTTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922391794 Original CRISPR CTGTGGATATAGTTGGGGGT GGG Intronic
902216402 1:14937000-14937022 ATGTGGACTTAGTTCGGGGTGGG - Intronic
904083202 1:27885068-27885090 ATGAGGATAGGGTTGGGGGTTGG - Intronic
905003975 1:34695693-34695715 CTGTGAATAAAGGTGGGGATTGG - Intergenic
905509207 1:38505260-38505282 ATGTGGATACATTTGGGAGTCGG + Intergenic
905784853 1:40746798-40746820 CTGTGGATATAGTTTAGGAAAGG - Intronic
906237337 1:44219922-44219944 CTGTGGATATAGGTTGGGCAGGG + Intronic
906268118 1:44450288-44450310 CTGTAGATATAGCAGGAGGTTGG + Intronic
906666949 1:47628635-47628657 CTGGGGATGGAGTGGGGGGTGGG + Intergenic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
908178819 1:61583793-61583815 CTGTGCATGTATTTGGGAGTGGG + Intergenic
910689194 1:89948695-89948717 GTGTGGCTATATTTGGAGGTGGG - Intergenic
911144450 1:94539243-94539265 GTGTGGATATGTATGGGGGTGGG - Intronic
913320149 1:117582319-117582341 CTGTTGTTATGGGTGGGGGTGGG + Intergenic
914258392 1:145978768-145978790 TTGTGGAGATAATTAGGGGTGGG + Exonic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
914573039 1:148937559-148937581 TTGTGTATATATTTGGGGGCTGG + Intronic
915931034 1:160061152-160061174 TTGTAGATAGGGTTGGGGGTGGG + Intronic
915996274 1:160567423-160567445 CTGAGGATTTAGTTGGGGGTTGG + Intronic
916714485 1:167438117-167438139 CTGTGGGTATACCTGTGGGTAGG - Intronic
918618861 1:186579349-186579371 CTCTGGCAATAGTTTGGGGTAGG - Intergenic
920362582 1:205429593-205429615 CTGTGGAGATAGCCGGGGTTGGG + Intronic
920599304 1:207306783-207306805 CTGTGGATAAAGTAGTGGGGTGG + Intergenic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
923292511 1:232560254-232560276 CTGGGGATGTGGTTTGGGGTAGG - Intronic
924169978 1:241328806-241328828 CTGTAGATTTATTTGGGGGTAGG - Intronic
1064877212 10:20007752-20007774 CAGGTGATATAGTTGTGGGTAGG + Intronic
1067361616 10:45586222-45586244 CTGAGGTTATAGGTAGGGGTGGG - Intronic
1068442987 10:57083781-57083803 ATACTGATATAGTTGGGGGTGGG + Intergenic
1068597812 10:58922328-58922350 CAGTCCATATATTTGGGGGTGGG + Intergenic
1068657745 10:59592160-59592182 CTGTGGTGTTGGTTGGGGGTAGG - Intergenic
1069825302 10:71251367-71251389 CTTTTGATATAGTAGGTGGTAGG + Intronic
1071742390 10:88374926-88374948 TTGTGGTTATAGTAGGGAGTAGG - Intronic
1071982593 10:91018842-91018864 TTGTGGAATTAGTGGGGGGTTGG - Intergenic
1072763737 10:98079645-98079667 GTGTGTATAGAGTTGGGGGCGGG + Intergenic
1073250136 10:102116018-102116040 GTGTGAATATAGTTGGGGGTAGG - Intronic
1075077115 10:119359011-119359033 ATGTGACTATATTTGGGGGTGGG - Intronic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1079032262 11:16994502-16994524 CTGCGGACATAGGTGGGGGCTGG + Intronic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1092582750 12:9863287-9863309 CTGTCGATTTTTTTGGGGGTGGG - Intronic
1092741146 12:11630803-11630825 CTGTTGATTTAGTTGTGGGGAGG + Intergenic
1093025390 12:14240865-14240887 GTGTGGTAAGAGTTGGGGGTGGG - Intergenic
1095246806 12:39932864-39932886 CAGGGGATAAAGGTGGGGGTGGG + Intronic
1095516101 12:43007204-43007226 CTGTGGATACAGTTGCTAGTGGG - Intergenic
1096585955 12:52619801-52619823 CTATGGATATATTTGGGATTTGG - Intergenic
1096643070 12:53010320-53010342 CTTTTGATTTAGTTGGGGATTGG - Intronic
1097302546 12:58034272-58034294 CTGTGGCCATTGTTGGGGATGGG + Intergenic
1098199772 12:68042368-68042390 GCGTGGGTGTAGTTGGGGGTAGG + Intergenic
1100918552 12:99455737-99455759 CTGTGGCTACTGTTGGGGGTGGG - Intronic
1101299849 12:103467845-103467867 CTGTGTATCCATTTGGGGGTGGG + Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1104712242 12:130995135-130995157 CTGTGGGAAGAGTTGGTGGTGGG + Intronic
1104767560 12:131340352-131340374 CTGTGGGTGAAGTTGGGGGGCGG + Intergenic
1105383932 13:19912885-19912907 TTTTGGTTATAGTTGGGGGCAGG - Intergenic
1107018739 13:35730557-35730579 GTGTGGATATATTTGGAGATTGG + Intergenic
1111830774 13:93326127-93326149 CTGTGTGTATAGTTGAGGGGTGG + Intronic
1113574169 13:111382529-111382551 CTGTGGTGATGGGTGGGGGTCGG + Intergenic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1122226126 14:100281116-100281138 CTTTGCCTATAGTCGGGGGTGGG - Exonic
1124505538 15:30269956-30269978 GTGTGGCTATATTTGGAGGTGGG + Intergenic
1124738014 15:32268675-32268697 GTGTGGCTATATTTGGAGGTGGG - Intergenic
1126711713 15:51464759-51464781 GTGTTGATATAGTTAGGGGGTGG + Exonic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129236243 15:74225414-74225436 GGGTGGATGGAGTTGGGGGTGGG - Intergenic
1129517509 15:76165624-76165646 CTGGGGCTATGGCTGGGGGTGGG + Intronic
1135415565 16:22265947-22265969 ATCTGGATTTGGTTGGGGGTGGG - Intronic
1136620144 16:31423230-31423252 TTGTGGATAAAGTTGGAAGTTGG + Intronic
1138173110 16:54871515-54871537 ATGTGGATTTAGTGGGAGGTGGG - Intergenic
1138500429 16:57439396-57439418 CTGTAGCTTTTGTTGGGGGTTGG - Intronic
1139168725 16:64603682-64603704 GTGTGGATTTTGGTGGGGGTGGG - Intergenic
1143121380 17:4609367-4609389 CTGTGGTCTTTGTTGGGGGTGGG + Intergenic
1144956211 17:19020119-19020141 GTGAGGATAGGGTTGGGGGTGGG - Intronic
1150007899 17:61480820-61480842 TTGTGGATGTAGGTGGGGGCTGG + Intronic
1150417007 17:64995958-64995980 GTGTGGATATATTTTGGGGAGGG - Intergenic
1150575272 17:66425267-66425289 CTGTGGATGTTGGTGGAGGTGGG - Intronic
1150794662 17:68227966-68227988 GTGTGGATATATTTTGGGGAGGG + Intergenic
1151253248 17:72854299-72854321 CTGGGGATGAAGTGGGGGGTGGG + Intronic
1152900814 17:82940051-82940073 GTGTGTATTGAGTTGGGGGTGGG + Intronic
1157131219 18:45009120-45009142 CTGTGGGTACAGTTGGCGGCTGG - Intronic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1159062400 18:63529709-63529731 CTGTATGTATAGTTTGGGGTGGG + Intergenic
1159644182 18:70898093-70898115 TTGTGGAGAAAGTTGGAGGTGGG - Intergenic
1159923502 18:74247050-74247072 GTGAGGAGATAGTGGGGGGTGGG - Intergenic
1161149982 19:2702540-2702562 CTGCGGACCGAGTTGGGGGTCGG - Intronic
1161692175 19:5742607-5742629 TTGTAGATATGGTGGGGGGTGGG - Intronic
1161937662 19:7382067-7382089 CTGGGGATGGAGTTTGGGGTGGG + Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1165469849 19:35996884-35996906 TTGTGGATGTAGCTGTGGGTAGG + Intergenic
1166366676 19:42281476-42281498 CTGTGGAGTTGGTTAGGGGTTGG + Intronic
1166481169 19:43175583-43175605 CAGTGAATATAGTGGGGGTTCGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166983364 19:46645091-46645113 CTGTGGATTCAGGTGGGGGCTGG + Intergenic
1167019591 19:46863321-46863343 CTGGGTAAATAGGTGGGGGTTGG + Intergenic
1167057396 19:47120580-47120602 CAGTGGATATTCTGGGGGGTGGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931193119 2:60024626-60024648 CTTTGGTTGTGGTTGGGGGTTGG - Intergenic
931627694 2:64271659-64271681 CAGTGGATAAAGATGGGGCTGGG + Intergenic
932614186 2:73221671-73221693 CTGGGGAGATGGTTGTGGGTGGG + Intronic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
933996827 2:87676275-87676297 CTATGGACATACTTGGGGGTGGG + Intergenic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
936290635 2:111221083-111221105 CTGTGGCTGTATTTGGGTGTGGG - Intergenic
936297024 2:111274635-111274657 CTATGGACATACTTGGGGGTGGG - Intergenic
937033719 2:118763434-118763456 CTATGTATAAAATTGGGGGTGGG + Intergenic
937037489 2:118794025-118794047 CTGTGCATTTTGTTAGGGGTGGG + Intergenic
940043662 2:149386986-149387008 CTGTGGGTCATGTTGGGGGTGGG - Intronic
941247044 2:163111781-163111803 CTGGGGCTATGGGTGGGGGTGGG - Intergenic
941899706 2:170666461-170666483 CTGTGAATATAGCGGGTGGTTGG + Intergenic
947497627 2:230649752-230649774 CTGTGGTTGGAGTTGGAGGTGGG + Intergenic
948926019 2:241098538-241098560 ATGTGAATATTGTTGGGGGCAGG + Intronic
948950299 2:241246255-241246277 CTGGGGATAGAAGTGGGGGTGGG + Intronic
1173654455 20:44690150-44690172 CTGTGGAGATAGTAAGGGGAGGG - Intergenic
1173888318 20:46481016-46481038 CTGTGTGTGTGGTTGGGGGTAGG + Intergenic
1174084821 20:47999753-47999775 CTGTGGATATCCGTGGGGGGCGG + Intergenic
1175472416 20:59240113-59240135 CTGTGGGGGTAGGTGGGGGTGGG - Intronic
1175622758 20:60464167-60464189 CTGTTGGTTTAGTTGGGTGTAGG + Intergenic
1176944203 21:14958509-14958531 TTGTGGATGTTGTTGGGGGTGGG + Intergenic
1177191860 21:17860946-17860968 CTATTCAAATAGTTGGGGGTGGG + Intergenic
1178380411 21:32102963-32102985 CTATGGATATATTTGGGGCAGGG - Intergenic
1180633123 22:17243711-17243733 GTGTGGAGAAAGTGGGGGGTAGG - Intergenic
1180788003 22:18557701-18557723 AGGTGACTATAGTTGGGGGTTGG - Intergenic
1181233735 22:21437617-21437639 AGGTGACTATAGTTGGGGGTTGG + Intronic
1181244915 22:21497226-21497248 AGGTGACTATAGTTGGGGGTTGG - Intergenic
1183520188 22:38292434-38292456 CTGGGCAGATATTTGGGGGTGGG - Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1184808683 22:46813716-46813738 CTGGGGATTTGGCTGGGGGTGGG + Intronic
949920874 3:8999543-8999565 CTGGGGATGAAGTAGGGGGTGGG - Intronic
951292072 3:20883473-20883495 CTGTGGTAAAAGTTGGGGGGTGG - Intergenic
951626586 3:24671267-24671289 CTGTGGTTATAGTGGTGAGTAGG + Intergenic
951783936 3:26397220-26397242 CCCTGGATATCCTTGGGGGTTGG + Intergenic
952104807 3:30056659-30056681 TTGTGGTTATATTTGGGGATAGG - Intergenic
954600147 3:51861235-51861257 ATGTGGTTAGAGTTGGGGGTGGG - Intergenic
954928827 3:54262004-54262026 CTGTGAATGCAGTTGGGGATAGG + Intronic
955422140 3:58749354-58749376 CTGTGGGTAAAGTGGGGGTTAGG - Intronic
956766350 3:72487646-72487668 CTGTGTCTGTAGCTGGGGGTGGG + Intergenic
957842463 3:85689242-85689264 CTGTGGATGGAGGTGGGGGTAGG + Intronic
958044826 3:88271001-88271023 CTGTGGGTAGAGCTGAGGGTGGG - Intergenic
958647106 3:96887763-96887785 CTGTGGCTACTGTTGGGGATGGG + Intronic
958860740 3:99442652-99442674 CTGTATATATAGTTGAGTGTAGG - Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961683273 3:128613051-128613073 CTGGGGATACAGTCGGGAGTGGG - Intergenic
963823597 3:149926958-149926980 TTGTGCATATATTTGGAGGTGGG - Intronic
966066417 3:175827401-175827423 CTGTGGATATAGTTTTGACTAGG - Intergenic
966458059 3:180140842-180140864 TGGTGGTTATAGTTGGGGATTGG + Intergenic
969182132 4:5450326-5450348 CTGTGGATATGGTCAGGGGAAGG - Intronic
969649571 4:8457021-8457043 TTGTAGAGATAGTTGGGGGGGGG - Intronic
969998182 4:11336519-11336541 CTGTGGATAGAATTGGGGGAGGG - Intergenic
971131976 4:23821462-23821484 ATGTGAAAATAGTAGGGGGTGGG + Intronic
972834473 4:42853262-42853284 CTGGAGATGTAGTTGGTGGTTGG - Intergenic
973118997 4:46494480-46494502 GTGTTGATATAGAAGGGGGTTGG + Intergenic
973294099 4:48496293-48496315 CTGTTGATTTGGTTGGGGGTAGG + Intergenic
973588837 4:52420124-52420146 GTGTGGCTATATTTGGAGGTGGG - Intergenic
973714620 4:53663414-53663436 CTGAGGTGATAGTTGAGGGTGGG + Intronic
973908093 4:55550725-55550747 CTTTGGATATTATTGGTGGTGGG - Intergenic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
974639311 4:64608453-64608475 CTGTTGCTATGGTTGTGGGTAGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
977598289 4:98908182-98908204 CTGTGTGTATGATTGGGGGTGGG - Intronic
977962886 4:103105319-103105341 GTGTGGATTTATTTGGGGGGAGG - Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
981489861 4:145327874-145327896 CTGGGGATTAAGTTGGGGGTGGG + Intergenic
981604293 4:146526143-146526165 ATGTGGTTAGAGTGGGGGGTGGG - Intergenic
983222331 4:165054931-165054953 TTGTGTATAGAGTTGGGGGTGGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
986703029 5:10430125-10430147 TTCTGGATATACTTGGAGGTGGG + Intronic
986876915 5:12122457-12122479 CTGTGGATCTATTTGGGGCCAGG + Intergenic
987287857 5:16476747-16476769 CTGTCAATAGGGTTGGGGGTGGG + Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987846703 5:23296124-23296146 CTGTGGCTATTGTGGGGGATGGG + Intergenic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
988214821 5:28258128-28258150 CTGTGGTGATAGTTGAGTGTGGG + Intergenic
989208005 5:38830800-38830822 TTGCTGATATAGCTGGGGGTTGG + Intergenic
991721467 5:69497809-69497831 CTGTGAATAAAGTTTGGGATAGG + Intronic
995572596 5:113496000-113496022 CTGTGGTTATATTTGGGAGAAGG + Intergenic
995817805 5:116191610-116191632 CTGTGGCTGCTGTTGGGGGTTGG - Intronic
995817863 5:116191907-116191929 CAGTGGAGTTAGTGGGGGGTGGG - Intronic
998655527 5:144174365-144174387 TTGTGGATATAGCTGACGGTAGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1000873861 5:166611212-166611234 CTGTGTATGTGGTTGGGGGCGGG - Intergenic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1001148274 5:169203857-169203879 CTGTGGGTAGAGCAGGGGGTTGG + Intronic
1001729668 5:173942061-173942083 CTGATGAAAAAGTTGGGGGTGGG - Intronic
1001865261 5:175098436-175098458 CTTTGAATATAGCTGGGGGCTGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1003327144 6:5100568-5100590 CTGTGGTTAGAGGTGGGGGTGGG + Intergenic
1004427267 6:15514782-15514804 CTGTGACTGCAGTTGGGGGTAGG - Intronic
1005870528 6:29971608-29971630 CCCTGGACAGAGTTGGGGGTCGG + Intergenic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007444403 6:41894604-41894626 CTGGGGTAATAGTTGGGAGTAGG - Intronic
1008040271 6:46790029-46790051 GTGTGGAAATAGCTGGGGGCGGG + Intergenic
1011818537 6:91222903-91222925 CTGTGCAAATAGTTGGGTGGAGG + Intergenic
1011847384 6:91582912-91582934 CTGAGGATGGAGTTGGGGGATGG + Intergenic
1012164804 6:95935579-95935601 CTGTGGATAACGGCGGGGGTGGG - Intergenic
1012665820 6:101967927-101967949 CTGTTTATATGGTGGGGGGTGGG - Intronic
1015490761 6:133823162-133823184 ATGAGGATATAGATGGGTGTGGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016299523 6:142614640-142614662 CTGTGGAGATGGTTGGAGGGGGG + Intergenic
1018696454 6:166395289-166395311 CTGTGGATCCAGCTGGGCGTGGG - Intergenic
1019622452 7:1999255-1999277 CTGTAGAAATACTGGGGGGTGGG - Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1020512837 7:9081080-9081102 CTTCGGATATAGTTGGGTGCTGG + Intergenic
1022244645 7:28546883-28546905 GTGTGGATAGAGCTGGGGTTGGG + Intronic
1022488159 7:30796048-30796070 ATGTGGACATAGTTGAGGGAGGG + Intronic
1022629334 7:32070731-32070753 CTGTGGCTTTGTTTGGGGGTAGG - Intronic
1024248388 7:47487993-47488015 CTTACGATATAATTGGGGGTTGG + Intronic
1024291869 7:47810882-47810904 GTGTGGATATATGTGGGGATGGG + Intronic
1024819423 7:53310173-53310195 CTGTGGACATAATTTGGGGTAGG + Intergenic
1025073613 7:55923367-55923389 TTGTGAATATAGTTTGGGCTGGG + Intronic
1027006777 7:74701086-74701108 CTGTGGATGTTATTGGAGGTTGG + Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1028570448 7:92280662-92280684 TTTTGGCTAAAGTTGGGGGTTGG - Intronic
1029571738 7:101374322-101374344 CTCTGGAGGTAGTTAGGGGTGGG - Intronic
1030101267 7:105947532-105947554 TTGTGGATATAGTTGGAAGTAGG - Intronic
1031161661 7:118176146-118176168 ATGTGGACATCTTTGGGGGTTGG + Intergenic
1032283907 7:130526922-130526944 GTGGGGATATGGGTGGGGGTGGG + Intronic
1032590105 7:133183940-133183962 GTGTGTATATATTTGGGGGAGGG - Intergenic
1033367629 7:140683739-140683761 TGGTTGTTATAGTTGGGGGTTGG + Intronic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1034034531 7:147804881-147804903 CTGTGGACATAGCTTGGTGTGGG - Intronic
1034426716 7:151017922-151017944 CTGTGGATGTGGCTGGGGTTGGG - Exonic
1035180592 7:157086554-157086576 CTGTGTATATATGTAGGGGTGGG - Intergenic
1036413724 8:8527333-8527355 CTGGGGTTAGAGGTGGGGGTGGG - Intergenic
1037427980 8:18777797-18777819 CTGTGGATAGTGGTGGTGGTGGG - Intronic
1042667069 8:71218810-71218832 GTGTGGTTAGCGTTGGGGGTGGG + Intronic
1046928818 8:119823025-119823047 CTGAGGATATTGTGGGGAGTGGG - Intronic
1048073394 8:131042617-131042639 CAGTGTATGTGGTTGGGGGTGGG - Intergenic
1048850152 8:138637155-138637177 CTGTGGGTATAGTGTGGGATAGG + Intronic
1049579842 8:143406344-143406366 CTGTGGGTAGAGGTGGGGGTGGG - Intergenic
1051877282 9:21805912-21805934 CTGAGGAGAGAGATGGGGGTAGG + Intronic
1056244988 9:84686025-84686047 ATGTGTATATATATGGGGGTGGG - Intronic
1056595927 9:88007540-88007562 CTGCGGGAAGAGTTGGGGGTCGG - Intergenic
1060547122 9:124468265-124468287 ATGTGAAAATAGTTGGGGGCAGG - Intronic
1060822716 9:126670924-126670946 GTGTGGGTATAGCTGTGGGTAGG + Intronic
1061100990 9:128492348-128492370 CTTTGGATAGAGTTGAGGGTAGG + Intronic
1061141282 9:128768684-128768706 CTGAGGATATAGTCCGGGCTTGG + Intronic
1062167728 9:135116370-135116392 CTGAAGATGTAATTGGGGGTGGG - Intronic
1186417234 X:9394314-9394336 CTGAGGAAATAGCTGTGGGTCGG + Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1188316110 X:28675685-28675707 CTGTGGAGAAATATGGGGGTGGG + Intronic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1192457113 X:71285252-71285274 CCCTGGAAATAGTTGGGGATGGG - Intronic
1193588324 X:83355418-83355440 CCGTTAATTTAGTTGGGGGTGGG + Intergenic
1193772180 X:85600893-85600915 CTGTGGGTATGGGTAGGGGTAGG + Intergenic
1194768353 X:97869943-97869965 GTGTGGATGTAGTCGGGGTTGGG + Intergenic
1197200838 X:123747284-123747306 CTGAGAATATAGTTGGAAGTAGG + Intergenic
1197752777 X:129976980-129977002 CTATGGATTTAGTTAGAGGTTGG + Intergenic
1199412730 X:147543375-147543397 CAGAGGATATAGTGGGGAGTGGG + Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199982589 X:152929061-152929083 CTGGGGATGTTGGTGGGGGTGGG + Intronic
1201984246 Y:19947408-19947430 TTGTGGATTTTGTTGGGGGGTGG + Intergenic