ID: 922392382

View in Genome Browser
Species Human (GRCh38)
Location 1:225158328-225158350
Sequence GAAAATCCAGAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 899}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922392382 Original CRISPR GAAAATCCAGAGATGGGGCA GGG Intronic
900310925 1:2032760-2032782 GACAAGGCAGAGATGGGGCCAGG - Intergenic
900700793 1:4047531-4047553 GAGAACACAGAGATGGGGAAGGG + Intergenic
901440466 1:9275008-9275030 AAAAATCCAGAGTTGGGGCCGGG - Intergenic
902688256 1:18092980-18093002 GAATATCCAGAGAAGAGGAAAGG - Intergenic
903227421 1:21901763-21901785 CAAAATCCAGAGACAGTGCAGGG + Intronic
903401294 1:23052146-23052168 AAAAATCCAGATTTGGGGAAGGG + Intronic
903452159 1:23461511-23461533 TAAAAACCAGGCATGGGGCATGG + Intronic
904198254 1:28802083-28802105 GAAAAACCAGAGAAAGGGAAGGG + Intergenic
904219377 1:28952581-28952603 GAAAATACAGAAAAGGGGAAAGG + Intronic
904548959 1:31299088-31299110 CAAAAGCCAGATATGAGGCAAGG + Intronic
904710058 1:32423516-32423538 GAGAATCCAGAGGTGGGGAAGGG + Intergenic
904753499 1:32755188-32755210 GTGAATCCAGAGATGGGGGAAGG + Intronic
905184711 1:36188066-36188088 GAAAGGGCAGAGATGGGGAAAGG - Intergenic
905740787 1:40369586-40369608 GAAAAACAAGAAATGGGGAAAGG + Intronic
906216501 1:44043957-44043979 GCTAATCCAGAGGTGGGGGAGGG + Intergenic
906283068 1:44567014-44567036 GAAAAGCTAGAGATGGTGAAGGG + Intronic
906527582 1:46504474-46504496 GAAAAACAAGAAATGGGGAAAGG - Intergenic
907479563 1:54735971-54735993 CTAATTCCAGAGCTGGGGCAAGG - Intronic
907958572 1:59255679-59255701 GAAAAACAAGAAATGGGGAAAGG + Intergenic
907967558 1:59347687-59347709 GAAAAACAAGAAATGGGGAAAGG + Intronic
907970969 1:59381051-59381073 GAAAAACAAGAAATGGGGAAAGG - Intronic
907979005 1:59462189-59462211 GAAAAACAAGAAATGGGGAAAGG + Intronic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
908898536 1:68928233-68928255 GAAAAACAAGAAATGGGGAAAGG + Intergenic
908972840 1:69857992-69858014 GAAAAACAAGAAATGGGGAAAGG + Intronic
908978282 1:69924062-69924084 GAAAAACAAGAAATGGGGAAAGG - Intronic
908984138 1:69996658-69996680 GAAAAACAAGAAATGGGGAAAGG - Intronic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
909951157 1:81721995-81722017 GAAAATGCAGAGATAGGACCAGG + Intronic
910355713 1:86351352-86351374 GAAAAACAAGAAATGGGGAAAGG - Exonic
910384993 1:86672755-86672777 GAAAAACAAGAAATGGGGAAAGG + Intergenic
910482887 1:87677441-87677463 GAAAGTAGAGAGATGGGTCAGGG + Intergenic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
910786362 1:91002410-91002432 GAAAAACAAGAAATGGGGAAAGG + Intronic
910817009 1:91301665-91301687 GAAAAACAAGAAATGGGGAAAGG + Intronic
910822974 1:91371473-91371495 GAAAAACAAGAAATGGGGAAAGG + Intronic
911224822 1:95293494-95293516 GAAAAACAAGAAATGGGGAAAGG - Intergenic
912064061 1:105713076-105713098 GTAAATCCATAAATGGGGCTGGG - Intergenic
913080792 1:115384607-115384629 GAAAAACAAGAAATGGGGAAAGG - Intergenic
913152315 1:116056787-116056809 GAAAAACAAGACATGGGGAAAGG + Intronic
913168989 1:116215119-116215141 GAAAAACAAGACATGGGGAAAGG + Intergenic
913258767 1:116979602-116979624 GAAAAACAAGACATGGGGAAAGG + Intronic
913302108 1:117382441-117382463 GAAAAACAAGACATGGGGAAAGG - Intronic
913341788 1:117765231-117765253 GAAAAACAAGAAATGGGGAAAGG - Intergenic
913388550 1:118285634-118285656 GAAAAACAAGACATGGGGAAAGG + Intergenic
913611550 1:120514204-120514226 GCAGATGCAGAGGTGGGGCAGGG - Intergenic
913721364 1:121599453-121599475 GAAAAACAAGAAATGGGGAAAGG - Intergenic
913983244 1:143542603-143542625 GCAGATGCAGAGGTGGGGCAGGG + Intergenic
914375365 1:147068790-147068812 GAAAAACAAGAAATGGGGAAAGG + Intergenic
914579642 1:149008035-149008057 GCAGATGCAGAGGTGGGGCAGGG + Intronic
914890700 1:151620041-151620063 AAAACTTCAGAGAAGGGGCAAGG + Intronic
914966270 1:152260506-152260528 GAAAAACAAGAAATGGGGAAAGG - Intergenic
915093428 1:153442572-153442594 GAAAAACAAGAAATGGGGAAAGG + Intergenic
915255986 1:154629189-154629211 GAAGATCCAGAGATTGGGGGTGG + Intergenic
915489377 1:156242838-156242860 GAAAAGGCAGAGCTGGGCCAAGG + Intronic
915761276 1:158315917-158315939 GAAAAACCAGCAATGGGGAAAGG - Intergenic
916585334 1:166144947-166144969 GAAAAGACAGAGATGGGGTGAGG + Intronic
916846943 1:168660824-168660846 GAAAAACAAGAAATGGGGAAAGG - Intergenic
917244159 1:172982535-172982557 GAAAAACAAGAAATGGGGAAAGG - Intergenic
917413228 1:174781825-174781847 GAAAAACAAGAAATGGGGAAAGG - Intronic
917546186 1:175970978-175971000 GTAAATCGAGAGAAGGGGAAGGG + Intronic
917842087 1:178988858-178988880 GAAAATCAAGCAATGGGGAAAGG - Intergenic
919303587 1:195801497-195801519 GAAAAACAAGAAATGGGGAAAGG + Intergenic
919391167 1:196987622-196987644 GAAAAACAAGAAATGGGGAAAGG - Intronic
919787107 1:201265696-201265718 AAAAATCAAGAGGTGGGGGAAGG - Intergenic
920106387 1:203556324-203556346 GAAAGTCCAGGGTTGGGGGATGG + Intergenic
920414451 1:205789432-205789454 CAAATTCCAGAGATGAGGAAGGG + Exonic
920730017 1:208474601-208474623 GAAACTCCATCGATGGGGCAAGG - Intergenic
920916191 1:210259932-210259954 GGAGCTCCAGAGATGGGGCAGGG + Intergenic
920944113 1:210512210-210512232 GCAGACCCAGAGATGGGACAGGG + Intronic
921276949 1:213530203-213530225 GAAAAACAGGAGATGGGCCAAGG - Intergenic
922310173 1:224381285-224381307 AAAAATACAAAAATGGGGCACGG + Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922589360 1:226762649-226762671 GAATATCCCTAGGTGGGGCAGGG + Intergenic
922990701 1:229908556-229908578 CAGAATCCTGAGATGAGGCAAGG + Intergenic
923511295 1:234656163-234656185 GAAAAACCGGAGCTGGGGCCTGG - Intergenic
923627723 1:235627883-235627905 TAAAATACAGATATGGGGCCGGG + Intronic
923714804 1:236415815-236415837 GACAATCCAGAGATGAGGGGTGG + Intronic
923913950 1:238481991-238482013 GAAAAGACAGAGAAGGGGAAAGG + Intergenic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
924873634 1:248076106-248076128 GAAAAACAAGAAATGGGGAAAGG - Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063793794 10:9486459-9486481 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1063797117 10:9524749-9524771 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1063883816 10:10557293-10557315 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1064522474 10:16217526-16217548 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1064866430 10:19885613-19885635 GAAAAACAAGAAATGGGGAAAGG - Intronic
1065396853 10:25248574-25248596 GAAAAACAAGAAATGGGGAAAGG - Intronic
1066138941 10:32483755-32483777 GAAAAACAAGAAATGGGGAAAGG - Intronic
1066155088 10:32667628-32667650 GAAAAACAAGAAATGGGGAAAGG - Intronic
1066163439 10:32759475-32759497 GAAAAACAAGAAATGGGGAAAGG + Intronic
1066445445 10:35478520-35478542 GAAAAACCAGCTATGGGGAAAGG + Intronic
1066952445 10:42134258-42134280 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1067301086 10:45010434-45010456 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1067336232 10:45366897-45366919 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1067567235 10:47348335-47348357 TAAACTCCTGAGTTGGGGCAAGG - Intergenic
1067783570 10:49226714-49226736 CAAAAAGCAAAGATGGGGCAAGG + Intergenic
1067934947 10:50602225-50602247 GAAGAAGCAGAGATGGGGCAGGG - Intronic
1068849559 10:61721217-61721239 GAAAAAGCAGAGGTGGGGCCGGG - Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069274460 10:66572085-66572107 AAAAATCCAGATATGAGGCCGGG + Intronic
1069278122 10:66618442-66618464 GAAAAACAAGAAATGGGGAAAGG + Intronic
1069795299 10:71048042-71048064 GAGAATCCAGAGATGGACCCAGG + Intergenic
1069986272 10:72286375-72286397 GAAAATCCCCCGATGGGGGAAGG - Intergenic
1070349745 10:75580800-75580822 CAAAATCAAGAAATGGGGAAAGG + Intronic
1070385987 10:75925001-75925023 GAAAAGCCAGAAATCGGCCAAGG - Intronic
1071323317 10:84487003-84487025 GAAAAACAAGAAATGGGGAAAGG - Intronic
1071850774 10:89567908-89567930 GAAAATAAAGTAATGGGGCATGG + Intergenic
1071878284 10:89866191-89866213 GGAAGTCTAGAGATGGGGAAAGG + Intergenic
1071891636 10:90014315-90014337 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1071994715 10:91136568-91136590 GAAATTCCATAAATCGGGCACGG - Intergenic
1072405869 10:95152248-95152270 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1072756647 10:98025919-98025941 GAAAACCCTGAGGTGGGGCAGGG + Intronic
1073614136 10:104975792-104975814 GAAAAACCAGCAATGGGGAAAGG + Intronic
1073660989 10:105476076-105476098 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1073864392 10:107785134-107785156 GAAAAGCCAAAGAAGGGACAAGG - Intergenic
1073892633 10:108118723-108118745 GAAAAACCAGCAATGGGGAAAGG + Intergenic
1073943485 10:108724698-108724720 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1074207998 10:111301207-111301229 GAGAACCCAGTAATGGGGCAGGG + Intergenic
1076931615 10:133535452-133535474 CAAAGGCCAGGGATGGGGCACGG - Intronic
1077785396 11:5378192-5378214 GAAAAACAAGAAATGGGGAAAGG + Intronic
1077787153 11:5396935-5396957 GAAAAACAAGAAATGGGGAAAGG + Intronic
1077861101 11:6180680-6180702 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1078242366 11:9541595-9541617 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1079365303 11:19803862-19803884 GATAAGCCACAGATGGGGCGAGG - Intronic
1079392073 11:20031192-20031214 GAAATTCCAGAGAAGTGGCTTGG - Intronic
1079534868 11:21501866-21501888 AAAATGCCAGAGAAGGGGCAAGG - Intronic
1079830081 11:25253786-25253808 GTAAATCCAGAGAAAGGCCAGGG - Intergenic
1079883251 11:25952901-25952923 GAAGATCCAGAGAATTGGCAGGG - Intergenic
1080365158 11:31565633-31565655 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080769732 11:35329582-35329604 GAATATTCAGGGATGGGGCTTGG - Intronic
1080810462 11:35699044-35699066 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080811375 11:35707644-35707666 CAAAAACAAGAGATGGGGAAAGG + Intronic
1080844827 11:36017682-36017704 AAAAATACAGTCATGGGGCATGG - Intronic
1080915312 11:36651812-36651834 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080917909 11:36678798-36678820 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1080991265 11:37538558-37538580 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1081168796 11:39840828-39840850 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1081204504 11:40259671-40259693 GAAAAACAAGAAATGGGGAAAGG - Intronic
1081309169 11:41549657-41549679 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1081413962 11:42791243-42791265 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1081499753 11:43654655-43654677 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081505703 11:43714383-43714405 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081958400 11:47114107-47114129 CAAAATCAAGAAATGGGGAAAGG - Intronic
1082109619 11:48260109-48260131 GAAAAACCAGCAATGGGGAAAGG + Intergenic
1082112019 11:48287432-48287454 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1082112952 11:48297300-48297322 GAAAAACAAGCGATGGGGAAAGG + Intergenic
1082135378 11:48543165-48543187 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1082719490 11:56656279-56656301 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1082723771 11:56710668-56710690 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1082878292 11:58011105-58011127 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1083361796 11:62113965-62113987 GGAACTCCAGAGGTGGGGCTTGG + Intergenic
1084413481 11:69017076-69017098 GAAGAACCAGACATGGGGCATGG + Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084780828 11:71407273-71407295 GAAGAGCCAGAGATGGGAGACGG + Intergenic
1085495858 11:76968674-76968696 GAAAAACAAGAAATGGGGAAAGG + Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086580645 11:88394360-88394382 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1086870534 11:92031625-92031647 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1086874392 11:92077406-92077428 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1088370077 11:109079339-109079361 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1089154932 11:116394446-116394468 GAAAATGCAGAGAGGGGTCACGG - Intergenic
1089423039 11:118346131-118346153 GCCAATCCAGAAATGTGGCAGGG + Intronic
1089589326 11:119530451-119530473 AAAAAGCCAGAGCTGGGGAAGGG + Intergenic
1090168920 11:124581233-124581255 GAAAAGCAAGAGATGAGGCCTGG + Intergenic
1090319878 11:125833047-125833069 GAGAAGACAGATATGGGGCAGGG + Intergenic
1090579562 11:128144931-128144953 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1090781272 11:130009085-130009107 GAAAATCCAGATTTGAGGCCAGG + Intergenic
1091213052 11:133880365-133880387 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1091627280 12:2131564-2131586 GAAAAACAAGAAATGGGGAAAGG - Intronic
1092081937 12:5723594-5723616 GAAATTACAGAGAAGGGGCAGGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092219242 12:6701328-6701350 GATAATCCAAAGATGGTGCAAGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092641743 12:10519240-10519262 GAAAATCAAGCAATGGGGAAAGG + Intronic
1093123001 12:15295334-15295356 GAACACCCAGAGCTGGGGGATGG - Intronic
1093256527 12:16874662-16874684 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1093766650 12:22971165-22971187 GAAAATCCTGAGATGGCTCTTGG - Intergenic
1093807190 12:23448884-23448906 GAAAAGCAAGAAATGGGGAAAGG + Intergenic
1094283367 12:28764776-28764798 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1095679363 12:44955705-44955727 GAAAATCAAGCAATGGGGAAAGG + Intergenic
1096932343 12:55226086-55226108 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1097037076 12:56131006-56131028 GAAATTCCTGAGAGAGGGCAGGG - Intronic
1097253214 12:57651216-57651238 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1097321192 12:58228199-58228221 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1097453446 12:59765592-59765614 CAAAATCAAGAAATGGGGAAAGG - Intronic
1097525418 12:60728088-60728110 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1097562278 12:61222147-61222169 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1099696020 12:86020467-86020489 CAAAAACAAGAGATGGGGAAAGG + Intronic
1099726917 12:86442604-86442626 GAAAAACAAGAAATGGGGAAAGG - Intronic
1099788266 12:87295826-87295848 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1100259605 12:92920479-92920501 GAAAAACAAGAAATGGGGAAAGG + Intronic
1101014295 12:100483532-100483554 GAAAATCCAGAGACACGTCAAGG - Intronic
1101297485 12:103439139-103439161 GAAAAACAAGAAATGGGGAAAGG + Intronic
1102052548 12:109873337-109873359 GAAAAGCCAGAGCTGAGGCTGGG + Intronic
1102223836 12:111213879-111213901 GAAATTTAAGAGGTGGGGCAGGG + Intronic
1102590928 12:113956283-113956305 GAAAATACAGGGCTGGGGCCAGG + Intronic
1102865230 12:116368982-116369004 GAAAATCCAGGGAAATGGCAGGG + Intergenic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1103410674 12:120709845-120709867 GAGAATGCCGAGATGGTGCACGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104820024 12:131671856-131671878 GAGATTCCAGGGTTGGGGCAGGG - Intergenic
1104990581 12:132621868-132621890 GAAGGGGCAGAGATGGGGCAAGG - Exonic
1105590785 13:21791080-21791102 GGATGTCCAAAGATGGGGCATGG - Intergenic
1106776070 13:33011060-33011082 AGCATTCCAGAGATGGGGCAGGG + Intergenic
1106859317 13:33887888-33887910 GAAAAACAAGAAATGGGGAAAGG - Intronic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1107487249 13:40840601-40840623 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1107492228 13:40891824-40891846 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1107635292 13:42386197-42386219 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1107639747 13:42429629-42429651 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1107971766 13:45649784-45649806 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1108712397 13:53046483-53046505 GAAAAACCAGATATGTAGCAGGG + Intronic
1108989215 13:56633648-56633670 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1109572596 13:64212314-64212336 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1109774862 13:67027296-67027318 GAAAAACAAGAAATGGGGAAAGG + Intronic
1110586931 13:77203777-77203799 GAAAAACAAGAAATGGGGAAAGG + Intronic
1110890722 13:80694479-80694501 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1111101989 13:83599934-83599956 GAAAATGCAGAGAAGGGCCCGGG + Intergenic
1111622605 13:90743895-90743917 GAAAATAGAGAGAAGGGGAAAGG - Intergenic
1112242096 13:97692487-97692509 AGAAGTCCAGAGAGGGGGCATGG + Intergenic
1112829427 13:103430217-103430239 GTAAGTCCAGATATGGGGAAGGG - Intergenic
1113107690 13:106789120-106789142 GACAAGCAAGAGATGGGGGAGGG + Intergenic
1114044131 14:18706993-18707015 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1114346874 14:21805770-21805792 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1114668485 14:24396264-24396286 CAAGTTCCAGAGATGGGGCAGGG - Intergenic
1114800705 14:25772579-25772601 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1115005181 14:28473982-28474004 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1115158659 14:30368285-30368307 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1115161594 14:30402551-30402573 GAATATCAAGAGATGTTGCATGG + Intergenic
1115523133 14:34252841-34252863 GAATTTCCAGGAATGGGGCATGG + Intronic
1115895868 14:38086261-38086283 GAAATTCTAGAGGTGGAGCAGGG + Intergenic
1116011244 14:39354820-39354842 GAAAAACAAGAAATGGGGAAAGG - Intronic
1116022831 14:39482490-39482512 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1116062033 14:39935918-39935940 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1116547009 14:46181312-46181334 GAAAAACCAGCAATGGGGAAAGG + Intergenic
1116733708 14:48659854-48659876 GAAAAACAAGAAATGGGGAACGG + Intergenic
1116979450 14:51152533-51152555 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1116994956 14:51313483-51313505 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1117087115 14:52213013-52213035 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1117213524 14:53526410-53526432 GTAAATCCAGGGTGGGGGCAGGG + Intergenic
1117952162 14:61093528-61093550 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1118324504 14:64772004-64772026 GGCACTCCAGTGATGGGGCAGGG + Intronic
1118700687 14:68430007-68430029 CAAAATCAAGAAATGGGGAAAGG - Intronic
1119619861 14:76123963-76123985 GAAAATCCAGAGTTAGGGACTGG - Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120633120 14:86915746-86915768 GGAAATCCTGAGATTGGGCTTGG - Intronic
1121288769 14:92757505-92757527 CAAAATCAACAGATTGGGCAGGG - Intergenic
1121376318 14:93414286-93414308 GAAAAACAAGAAATGGGGAAAGG - Intronic
1122929038 14:104925020-104925042 GAAAAGCCAGGCATGGGGAAAGG + Intronic
1123227120 15:17050586-17050608 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1123815438 15:23973685-23973707 AAAAATCCAAAAATTGGGCATGG - Intergenic
1123889129 15:24757752-24757774 GAACATGCAGAGATGGTGGAGGG + Intergenic
1123999556 15:25743488-25743510 AAAAATCCAGAGTTGAGGCTGGG + Intronic
1124556390 15:30729598-30729620 GAAAATGCAGAGATGTGTGAGGG - Intronic
1124587513 15:31023359-31023381 GCAAAGCCAGAGAGAGGGCAGGG + Intronic
1124674885 15:31676170-31676192 GAAAATGCAGAGATGTGTGAGGG + Intronic
1124703630 15:31940529-31940551 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1125355507 15:38813502-38813524 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1126934291 15:53688946-53688968 GAAAAACAAGAAATGGGGAAAGG + Intronic
1127223391 15:56904399-56904421 GAAAAACAAGAAATGGGGAAAGG + Intronic
1128182541 15:65616985-65617007 GAAAAACAAGAAATGGGGAAAGG - Intronic
1129026811 15:72583797-72583819 GAAAATCTTGGGATGGGGAAAGG + Exonic
1129201998 15:74008441-74008463 GAAAACCCATTGATGGGGCCGGG + Intronic
1129626599 15:77206996-77207018 GAAAAACAAGAAATGGGGAAAGG + Intronic
1131861530 15:96658982-96659004 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1131862271 15:96666623-96666645 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1131899270 15:97069828-97069850 GAGAATCAACTGATGGGGCAGGG - Intergenic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134260973 16:12650603-12650625 AAAAATGTAGAGATGGGGTAGGG - Intergenic
1134404811 16:13947158-13947180 GTGAGTCCAGAGATGGGGAAAGG - Intronic
1135005913 16:18822515-18822537 GAAAAACAAGAAATGGGGAAAGG - Intronic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1135724102 16:24841199-24841221 AAGAACCCAGAGATGGGGCTGGG - Intergenic
1135862764 16:26072011-26072033 CAAAATCCAAAGATAGGGAAAGG - Intronic
1135972783 16:27084565-27084587 GAAAGTCCAGAGGAGGGGTAGGG + Intergenic
1136722526 16:32337129-32337151 GAGGATCCAGAGAAAGGGCAGGG + Intergenic
1136840850 16:33543122-33543144 GAGCATCCAGAGAAAGGGCAGGG + Intergenic
1136873834 16:33833131-33833153 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1136915970 16:34197594-34197616 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1137220957 16:46450671-46450693 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1138762394 16:59560553-59560575 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1139516324 16:67454414-67454436 GAGCATTCAGAGATGGGGTAAGG + Intronic
1139839637 16:69868121-69868143 GAAACTCCAGATTTAGGGCAAGG + Intronic
1139971376 16:70777690-70777712 GAAGATGCGGAGGTGGGGCAGGG + Intronic
1140202141 16:72903346-72903368 GAAACTCTAGGGATGGGGCCAGG + Intronic
1140307021 16:73812511-73812533 CATAATAAAGAGATGGGGCAGGG + Intergenic
1141041707 16:80677992-80678014 GAAAAACAAGAAATGGGGAAAGG + Intronic
1141234722 16:82205035-82205057 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1141791392 16:86238028-86238050 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1141806078 16:86342393-86342415 GAAACTGCAGAGGTGGGGCCCGG + Intergenic
1141878607 16:86842987-86843009 GGAAAGGCAGAGATGGGGCAGGG + Intergenic
1203003905 16_KI270728v1_random:180635-180657 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1203135513 16_KI270728v1_random:1717042-1717064 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1203151015 16_KI270728v1_random:1843419-1843441 GAGCATCCAGAGAAAGGGCAGGG + Intergenic
1142490567 17:275961-275983 GAAAGTCCAGAGCTGGGAAATGG + Intronic
1142532662 17:593040-593062 GAAAAACAAGAAATGGGGAAAGG + Intronic
1143225708 17:5300928-5300950 GAAATTCTGGAGATGGGGCCCGG - Intronic
1143325101 17:6093480-6093502 CACAATCCAGAGATGGGGGAGGG - Intronic
1143363830 17:6392575-6392597 CAAAATCAAGAGACGGGGCTGGG + Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1145939740 17:28737030-28737052 GAAAAACAAGAAATGGGGAAAGG - Intronic
1146148158 17:30440669-30440691 GAAAAACAAGAAATGGGGAAAGG - Intronic
1146223774 17:31048804-31048826 GAGAATGCAGAGGTGGGGAAGGG + Intergenic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146573755 17:33974419-33974441 AAAAATCCAGGGATAGGGCTGGG - Intronic
1146812477 17:35914908-35914930 GAGAATCCAGAGGTGGGGAAGGG + Intergenic
1147262438 17:39216530-39216552 GAACATCCAGAGAAGGGAAATGG + Intronic
1147922152 17:43924280-43924302 GAGAATGCAGAGGTGGGGAAGGG + Intergenic
1147925628 17:43943739-43943761 GAAACTCCAGGGATCTGGCAGGG + Intergenic
1149134318 17:53346396-53346418 GAAAAACCAGAAATGGGGAAAGG + Intergenic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1149700090 17:58648101-58648123 GCAACTCCAGAGCTGAGGCAAGG + Intronic
1150178727 17:63091470-63091492 GAAAAACAAGAAATGGGGGAAGG - Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1150830552 17:68514715-68514737 GAAAATCCTTAGTTGGGGGAGGG - Intronic
1151210662 17:72541589-72541611 GGAAAGCAAGAGATGGGGGAAGG - Intergenic
1151285487 17:73107989-73108011 AAAAATCTTGAGATGGGGCCGGG + Intergenic
1153286422 18:3459202-3459224 GACAATTCATAGCTGGGGCAGGG - Intronic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1153402792 18:4699531-4699553 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1153705089 18:7737097-7737119 AAAATTCCAGAGTTGGGGCTGGG - Intronic
1153930072 18:9870535-9870557 GAAAGTGCAGAGCTGGGGGAGGG - Intergenic
1154129244 18:11722714-11722736 GAAAATACAAAAATTGGGCAGGG + Intronic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155178800 18:23325147-23325169 TGAAATCCAGAGATGGGGATGGG - Intronic
1155424959 18:25697287-25697309 GAAAATCCAGAGCTGCAACATGG + Intergenic
1156936540 18:42715738-42715760 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1158318995 18:56242910-56242932 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1159178271 18:64867066-64867088 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1159184119 18:64947642-64947664 GGTAACCCAGAGATGGGGAAGGG + Intergenic
1159412630 18:68101007-68101029 GAGAGTCCAGAGAAGTGGCAAGG - Intergenic
1159628234 18:70719172-70719194 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1159630230 18:70740714-70740736 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1159678009 18:71310360-71310382 GAGAATCCACAGTTGGGGAATGG + Intergenic
1160282287 18:77502740-77502762 GATGGGCCAGAGATGGGGCAGGG - Intergenic
1160486655 18:79299484-79299506 GAGACTGCAGAGAGGGGGCAGGG - Intronic
1160535458 18:79589299-79589321 GCAAACCCAGCGATGGGGCGAGG - Intergenic
1160923379 19:1531113-1531135 AAAAACCCAGAAACGGGGCAGGG + Intronic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161232352 19:3180593-3180615 CAGAGGCCAGAGATGGGGCATGG - Intergenic
1161359715 19:3841075-3841097 GTAGAGCCAGAGATGGGGCCTGG - Intronic
1162215989 19:9134462-9134484 GAGAAGCCAGAGATGTGTCAGGG - Intergenic
1162822219 19:13229865-13229887 GAAAGTCCAGGGTTTGGGCAGGG + Intronic
1163487115 19:17594554-17594576 GAAAAGCCAGAAAGGGGTCAGGG - Intergenic
1164318041 19:24112209-24112231 GAAAAACAAGCAATGGGGCAAGG - Intronic
1164318251 19:24114409-24114431 GAAAAACAAGCAATGGGGCAAGG + Intronic
1164333359 19:24282596-24282618 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1164349462 19:27318217-27318239 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1164750168 19:30647895-30647917 TAAAACCCGGAGATGGGGCCAGG - Intronic
1164862115 19:31570046-31570068 GAAAAGTCAGACATGGGGCCAGG + Intergenic
1165296422 19:34929858-34929880 GAAAATCCAGAGAGGAGAAAAGG - Intronic
1165326194 19:35115801-35115823 CAAAGTCAGGAGATGGGGCAGGG - Intergenic
1165930045 19:39351671-39351693 CAAAGTCAAGAGATGGGGGAGGG - Intronic
1166362436 19:42259143-42259165 GAAAAATCAGAGATGTGGCCAGG + Intergenic
1166984705 19:46652857-46652879 GGAAAACCAGAGCTGGGGAAAGG + Intronic
1167213894 19:48151185-48151207 CAAAATCAGGAGGTGGGGCAGGG + Intronic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1167553794 19:50179882-50179904 TAAAATTCAGATATGGGGGAAGG + Intergenic
1167589802 19:50398269-50398291 GAAAATAAAGAGATGTGCCAAGG + Intronic
1168382545 19:55936318-55936340 GAAAATCCAGAAATAGGGCTGGG + Intergenic
925253266 2:2460709-2460731 GAAAAGCCTGACATGGGGCCCGG - Intergenic
925572203 2:5324705-5324727 AAAAAGCCAGAGGTGGGGGAGGG - Intergenic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
925811733 2:7708016-7708038 GAAGATCTAGAGATGGGGGCGGG + Intergenic
926234777 2:11031756-11031778 GAAAACCCAGAGATAAGTCATGG - Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926662348 2:15481547-15481569 GCAAATACAGAGAAGTGGCATGG - Intronic
926662357 2:15481646-15481668 GCAAATACAGAGAAGTGGCATGG - Intronic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927719980 2:25376409-25376431 GAAGAGCCAGAGAGGGGCCACGG + Intergenic
928565020 2:32536565-32536587 GAAAAACAAGAAATGGGGAAAGG - Intronic
929140749 2:38664779-38664801 GAAATTCCAGAGGTGGGGACTGG + Intergenic
929923891 2:46193608-46193630 GGAAATCCAGAGAAGGGGGTAGG + Intergenic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
930275395 2:49304957-49304979 GAAAAACAAGAAATGGGGAAAGG + Intergenic
930368885 2:50479237-50479259 GAAAATGCAGAGTTGGGGAAAGG - Intronic
930407101 2:50972475-50972497 GAAAATCCATAGACTGGGGAGGG + Intronic
930848399 2:55931322-55931344 GTAAATAAAGAGATAGGGCAGGG - Intergenic
930850002 2:55950531-55950553 GAAAGTCCAGGGAAGGGGCTCGG + Intergenic
930904732 2:56552858-56552880 GAAAAGCAAGAAATGGGGAAAGG - Intergenic
930941328 2:57017762-57017784 GAAAAACAAGAAATGGGGAAAGG - Intergenic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
932019506 2:68068616-68068638 GAAAAACAAGAAATGGGGAAAGG + Intronic
932066771 2:68571554-68571576 GAAAAACAAGAAATGGGGAAAGG - Intronic
932111359 2:69004311-69004333 GAAAAACAAGAAATGGGGAAAGG + Intergenic
932294360 2:70611701-70611723 CACAAACCAGACATGGGGCATGG + Intronic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
932499528 2:72171356-72171378 GAAAATCCAGAGGTGATTCAGGG - Intergenic
932525326 2:72460087-72460109 GAAAAACAAGAAATGGGGAAAGG + Intronic
932945573 2:76225714-76225736 GAAAAACAAGAAATGGGGAAAGG - Intergenic
933047204 2:77554098-77554120 GAAAAGGGAGAGATGGGGCAAGG - Intronic
933471368 2:82729940-82729962 GAAAATCTAGGGATAGGGCATGG + Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
934250650 2:90351609-90351631 GAAAAACAAGAAATGGGGAAAGG - Intergenic
934258916 2:91451801-91451823 GAAAAACAAGAAATGGGGAAAGG + Intergenic
934302221 2:91783715-91783737 GAAAAACAAGAAATGGGGAAAGG + Intergenic
934320871 2:91970591-91970613 GAAAAACAAGAAATGGGGAAAGG + Intergenic
934468984 2:94497901-94497923 GAAAAACCAGCAATGGGGAAAGG + Intergenic
934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG + Intergenic
934555526 2:95285201-95285223 GAAGAGCCAGAGCTGGGACAAGG - Intronic
934690655 2:96356251-96356273 GAAAGGCCAGCGATGTGGCAAGG - Intronic
934997887 2:98982738-98982760 GAAAAACAAGAAATGGGGAAAGG + Intergenic
935758785 2:106299494-106299516 GGACATCCAGAGAAAGGGCATGG + Intergenic
935825663 2:106946565-106946587 GAAAAACAAGAAATGGGGAAAGG + Intergenic
936265888 2:111006329-111006351 GAAACTCCAGAGATAGGGAAAGG + Intronic
937345179 2:121121053-121121075 GCAAAGTCAGAGATGGGGCCCGG - Intergenic
938718926 2:134047622-134047644 GAAAAACAAGAAATGGGGAAAGG + Intergenic
940059194 2:149546348-149546370 GAAAAACAAGAAATGGGGAAAGG - Intergenic
940435408 2:153647725-153647747 GAAAAACAAGAAATGGGGAAAGG - Intergenic
940667509 2:156626570-156626592 GAAAACTGAGAGATGGGGCAAGG - Intergenic
940703211 2:157072483-157072505 GAAAAACAAGAAATGGGGAAAGG + Intergenic
941457967 2:165732924-165732946 GAAAAACAAGAAATGGGGAAAGG - Intergenic
941559214 2:167023715-167023737 GAAAATCAAGCAATGGGGAAAGG - Intronic
941680343 2:168391626-168391648 GAGAATCCAGAAATGTTGCAAGG + Intergenic
941773671 2:169368751-169368773 GAAAAACAAGAAATGGGGAAAGG + Intergenic
941941683 2:171045503-171045525 GAAAATACATAGACCGGGCACGG - Intronic
942056482 2:172188526-172188548 GAAAAACGAGAAATGGGGAAAGG - Intergenic
942621607 2:177850266-177850288 GAAAAACAAGAAATGGGGAAAGG + Intronic
943276154 2:185869344-185869366 GAAAAACAAGAAATGGGGAAAGG + Intergenic
943277387 2:185884449-185884471 GAAAAACAAGAAATGGGGAAAGG + Intergenic
943711236 2:191097501-191097523 GAAAAACAAGAAATGGGGAAAGG + Intronic
943987687 2:194643627-194643649 CAAAAACAAGAGATGGGGAAAGG + Intergenic
944075380 2:195723754-195723776 AAAAATACAGCCATGGGGCAAGG + Intronic
945342222 2:208669924-208669946 ACAAAGTCAGAGATGGGGCATGG - Intronic
945392946 2:209286575-209286597 GAAAAACAAGAAATGGGGAAAGG + Intergenic
945984156 2:216340752-216340774 GAAAATACAGTGTTGGGGTAGGG + Intronic
946201173 2:218071629-218071651 GAAAATGCTGAGATGGGGGATGG - Intronic
947096613 2:226573954-226573976 GAAAAACAAGAAATGGGGAAAGG - Intergenic
947116873 2:226781392-226781414 GTAAATCCTGAGTTGGGGTAGGG + Intronic
947290938 2:228573005-228573027 GAAAAACAAGAAATGGGGAAAGG + Intergenic
947892023 2:233632094-233632116 CAAAAACAAGAAATGGGGCAAGG - Intronic
948051558 2:234982823-234982845 GAGAACCCCGAAATGGGGCAGGG + Intronic
948240310 2:236426695-236426717 AAAAATCCAGAGGCCGGGCACGG - Intronic
948340641 2:237248400-237248422 GAAAAACAAGAAATGGGGAAAGG - Intergenic
948506818 2:238434015-238434037 GAGAAACCCAAGATGGGGCAGGG - Intronic
1168753904 20:302520-302542 GTTAATCGAGAGATGGGGCTGGG + Intergenic
1169196645 20:3686640-3686662 CTAAATCCAGAGGTGGGACAGGG - Intergenic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170502933 20:16993468-16993490 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1170989350 20:21287718-21287740 TAAAATCAAGGGATGGGGCCAGG + Intergenic
1171002719 20:21430827-21430849 GAAAATAGAGAGCTTGGGCATGG + Intergenic
1171434623 20:25111211-25111233 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172119414 20:32589044-32589066 AAAAATCCAGAGGCCGGGCATGG - Intronic
1172607749 20:36225955-36225977 GAAGAGAGAGAGATGGGGCATGG - Intronic
1173009330 20:39167562-39167584 GAAAATGCAGAATTGGGGAAGGG + Intergenic
1174582218 20:51579971-51579993 GACAAGTCCGAGATGGGGCATGG - Intergenic
1174736560 20:52971500-52971522 CAAAATGGAGAAATGGGGCAGGG + Intergenic
1174934287 20:54850975-54850997 AAGAATCCAGAGACTGGGCATGG + Intergenic
1174966454 20:55221567-55221589 GAAAAACGAGAAATGGGGAAAGG - Intergenic
1174971016 20:55275618-55275640 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1175495236 20:59409906-59409928 GAATAGACAGAGATGGGGTAAGG + Intergenic
1176316847 21:5254072-5254094 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1176644253 21:9334982-9335004 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1176687138 21:9859693-9859715 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1176700834 21:10047943-10047965 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1176879286 21:14171597-14171619 GAAAAACAAGAAATGGGGAAAGG + Intronic
1176880204 21:14183206-14183228 GAAAAACAAGAAATGGGGAAAGG + Intronic
1176881707 21:14202564-14202586 GAAAAACAAGAAATGGGGAAAGG + Intronic
1177728938 21:25003603-25003625 GAGAAGCCAGAGATAGGTCATGG - Intergenic
1178088799 21:29139878-29139900 AAAAAGCCAGAGATGGGGCCTGG - Intronic
1178134601 21:29613253-29613275 GAAATTCCTGAGATAGGGCAGGG - Intronic
1179958405 21:44754081-44754103 GAAAGTCAAGAGATGGGCCCAGG + Intergenic
1180245367 21:46543742-46543764 GCACATGCAGAGATGGGGCAAGG - Intronic
1180394294 22:12315521-12315543 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1180394658 22:12320007-12320029 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1180405086 22:12544741-12544763 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1180405451 22:12549228-12549250 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1180550347 22:16532359-16532381 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1180598634 22:16997905-16997927 GAAAAACAAGAAATGGGGAAAGG - Intronic
1181496909 22:23292332-23292354 GAAATTCCACAGAGCGGGCAGGG + Intronic
1182023950 22:27102764-27102786 GAGACTCCAGAGATGGGGAGTGG - Intergenic
1182502857 22:30760518-30760540 GAAAATCAATAAATGGGGCTGGG + Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1183172169 22:36196615-36196637 GGAACTCCAGAGAAGGGGCTGGG + Intronic
1183534040 22:38384978-38385000 GAAAAACAAGAAATGGGGAAAGG + Intronic
1184535071 22:45081250-45081272 AAAAAAGTAGAGATGGGGCAGGG - Intergenic
1184562442 22:45270975-45270997 AAACATCCAGAGGTTGGGCACGG - Intergenic
1184935867 22:47720016-47720038 GAACTTCCAGAGATGAGGCCGGG + Intergenic
1185035055 22:48470412-48470434 AAAAATCCAGAGAAGGGTTAGGG - Intergenic
1185075769 22:48681345-48681367 TAAAAACCAGAGATGAGGCCGGG + Intronic
950383778 3:12640100-12640122 GAAAAACAAGAAATGGGGAAAGG + Intronic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
951188609 3:19743176-19743198 TAAAATCCAGAGAAGAGGGAGGG + Intergenic
951199315 3:19859794-19859816 GAAAAACAAGAAATGGGGAAAGG + Intergenic
951234678 3:20220361-20220383 GAAAAACAAGAAATGGGGAAAGG - Intergenic
951238417 3:20262193-20262215 GAAAAACAAGAAATGGGGAAAGG - Intergenic
951247216 3:20355011-20355033 GAAAAACAAGAAATGGGGAAAGG - Intergenic
951440011 3:22711769-22711791 GAAAAACAAGAAATGGGGAAAGG + Intergenic
951892348 3:27579098-27579120 GAAAGTCAATAGATGGGGCCAGG + Intergenic
951950226 3:28192194-28192216 GCAAAAGCAGAGTTGGGGCAAGG + Intergenic
952937354 3:38410265-38410287 GAAAAACAAGAAATGGGGAAAGG + Intronic
952939407 3:38430814-38430836 GAAAAACAAGAAATGGGGAAAGG - Intergenic
953035403 3:39206491-39206513 AAAACTCAAGGGATGGGGCAGGG + Intergenic
953080861 3:39616253-39616275 CAAAATCAAGAAATGGGGAAAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
953571559 3:44075804-44075826 GAGAATCAAGAGATGGGGTGTGG + Intergenic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
953652244 3:44817500-44817522 GAAAAACAAGAAATGGGGAAAGG - Intronic
954416958 3:50397993-50398015 GAACCTCCAGGGGTGGGGCAGGG - Intronic
954844758 3:53545780-53545802 GATAAAACAGAGTTGGGGCAGGG + Intronic
955162721 3:56480473-56480495 GAAAAACAAGAAATGGGGAAAGG + Intergenic
955477704 3:59356048-59356070 GAAAAACAAGAAATGGGGAAAGG - Intergenic
955554940 3:60126787-60126809 GAAAATCCCCAGATCTGGCATGG - Intronic
955642531 3:61101320-61101342 CAAAATCAAGAAATGGGGAAAGG - Intronic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
956719975 3:72109071-72109093 GAATCTCCAGAGATGGGACAAGG + Intergenic
957007827 3:74971030-74971052 GAAAAACCAGCAATGGGGAAAGG - Intergenic
958079023 3:88721748-88721770 GAAAAACAAGAAATGGGGAAAGG - Intergenic
958155643 3:89752356-89752378 GAAAAACAAGAAATGGGGAAAGG + Intergenic
958162668 3:89836588-89836610 GAAAAACAAGAAATGGGGAAAGG + Intergenic
958207310 3:90419479-90419501 GAAAAACAAGAAATGGGGAAAGG - Intergenic
958448127 3:94239927-94239949 GAAAAACAAGAAATGGGGAAAGG - Intergenic
958466407 3:94464876-94464898 GATATTCAAGAGATGGAGCAAGG - Intergenic
958569878 3:95865257-95865279 GAAAAACAAGAAATGGGGAAAGG + Intergenic
958691019 3:97466354-97466376 GTAAATGCTGATATGGGGCAGGG - Intronic
958701703 3:97599526-97599548 GAAAAACAAGAAATGGGGAAAGG - Intronic
959152434 3:102623282-102623304 GAAAAACAAGAAATGGGGAAAGG + Intergenic
959235114 3:103710821-103710843 GAAAAACAAGAAATGGGGAAAGG + Intergenic
959556419 3:107724667-107724689 GAAAAACAAGAAATGGGGAAAGG - Intronic
959659432 3:108849604-108849626 CAAAATACAGAGCTGGGGTAGGG + Intronic
959954164 3:112216087-112216109 GAAAAACAAGAAATGGGGAAAGG + Intronic
959959905 3:112286386-112286408 GAAAATCAAGGGTTGGGGCAGGG - Intronic
960654336 3:119986066-119986088 GAAAAACAAGAAATGGGGAAAGG + Intronic
961093020 3:124131820-124131842 GAAAAGCCAGAAATGGGCCTGGG - Intronic
961291943 3:125854685-125854707 GAAAAACAAGAAATGGGGAAAGG + Intergenic
961303856 3:125941386-125941408 GAAAAACAAGAAATGGGGAAAGG + Intergenic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961341200 3:126221389-126221411 GAAAAACAAGAAATGGGGAAAGG - Intergenic
961387617 3:126531224-126531246 GAAACTCTAGAGGTGGGGCCCGG + Intronic
961597243 3:128028186-128028208 GAAAAACTAGAGAGGGGGCAGGG + Intergenic
961615618 3:128177405-128177427 TAAAATCCAGAGATGCGGGTGGG - Intronic
962309814 3:134317456-134317478 GAGGACCCAGAGATGGGGCTAGG - Intergenic
962663959 3:137634969-137634991 GAAAAACCAGCAATGGGGAAAGG - Intergenic
962905879 3:139801532-139801554 GAAAAACAAGAAATGGGGAAAGG + Intergenic
963109504 3:141675059-141675081 CAAAAACAAGAAATGGGGCAAGG + Intergenic
963340443 3:144026196-144026218 GAAAAACAAGAAATGGGGAAAGG + Intronic
963396359 3:144739830-144739852 GAAAAACAAGAAATGGGGAAAGG - Intergenic
963765207 3:149327477-149327499 AAAAATCCAGAGCTGGGGCTTGG + Intronic
964429585 3:156590900-156590922 CAAAAACCAGAAATGGGGAAAGG - Intergenic
964500662 3:157344907-157344929 CAAAAACCAGAAATGGGGAAAGG + Intronic
964839184 3:160975132-160975154 GAAAAACCAGCAATGGGGAAAGG - Intronic
965015101 3:163147735-163147757 GAAAAACAAGAAATGGGGAAAGG - Intergenic
965050111 3:163635643-163635665 GAAAAACAAGAAATGGGGAAAGG - Intergenic
965088763 3:164135784-164135806 GAAAAACAAGAAATGGGGAAAGG + Intergenic
965291070 3:166881692-166881714 GAAAAACAAGAAATGGGGAAAGG - Intergenic
967594583 3:191314702-191314724 CAACCTCCAGAGATGGGGAAGGG + Intronic
967813490 3:193780206-193780228 GGTAAAGCAGAGATGGGGCAAGG + Intergenic
1202742636 3_GL000221v1_random:70086-70108 GAAAAACAAGAAATGGGGAAAGG + Intergenic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
971432801 4:26585878-26585900 GATAATCCACAGACTGGGCAGGG - Intronic
971438199 4:26650975-26650997 GAAAAACCAGCAATGGGGAAAGG - Intronic
971492644 4:27230141-27230163 GAAAAACAAGAAATGGGGAAAGG - Intergenic
971556622 4:28020580-28020602 GAAAAACAAGAAATGGGGAAAGG + Intergenic
971602729 4:28615863-28615885 CAAAAACCAGAAATGGGGAAAGG - Intergenic
971702645 4:29998619-29998641 GAAAATTCAGTGATGCTGCAGGG - Intergenic
972460490 4:39297513-39297535 GAAAAACAAGAAATGGGGAAAGG - Intronic
972694366 4:41430558-41430580 TAAAATACAGAGATGGGGGCAGG - Intronic
972929251 4:44051005-44051027 GAAAAACAAGAAATGGGGAAAGG + Intergenic
973085187 4:46050052-46050074 GAAAATCCAGAGAAGATGCATGG + Intronic
973697185 4:53501576-53501598 GAAAAGACAGAGATGGGTCTGGG - Intronic
973859382 4:55046150-55046172 GAAAAACAAGAAATGGGGAAAGG + Intergenic
974113872 4:57556999-57557021 GAAAAACAAGAAATGGGGAAAGG - Intergenic
974571412 4:63654166-63654188 GAAAAACAAGAAATGGGGAAAGG - Intergenic
974812754 4:66966549-66966571 GAAAATCAAGCAATGGGGAAAGG - Intergenic
975139744 4:70906874-70906896 GAGATTCCAGAGATGGTGGATGG + Intronic
975150605 4:71016665-71016687 GAAAAACAAGAAATGGGGAAAGG + Intronic
975911289 4:79269963-79269985 GAAAAACAAGAAATGGGGAAAGG - Intronic
976142693 4:82008959-82008981 GAAAAACAAGAAATGGGGAAAGG + Intronic
976993654 4:91402654-91402676 GAAAAACAAGAAATGGGGAAAGG - Intronic
977288210 4:95135121-95135143 GAAAAACAAGAAATGGGGGAAGG - Intronic
977353736 4:95919506-95919528 GAAAAACAAGAAATGGGGAAAGG + Intergenic
977448316 4:97160934-97160956 GAAAAACAAGAAATGGGGAAAGG + Intergenic
977511725 4:97970541-97970563 GAAAAACAAGAAATGGGGAAAGG + Intronic
977538184 4:98280869-98280891 GAAAAACAAGAAATGGGGAAAGG - Intronic
977647003 4:99424138-99424160 GAAAAACAAGAAATGGGGAAGGG - Intronic
977947155 4:102926981-102927003 GAAAAACAAGAAATGGGGAAAGG + Intronic
977977215 4:103279623-103279645 CAAAATCAAGAAATGGGGAAAGG + Intergenic
977986643 4:103390259-103390281 GAAAAACAAGAAATGGGGAAAGG + Intergenic
978011299 4:103688129-103688151 GAAAAACAAGAAATGGGGAAAGG + Intronic
978133070 4:105222975-105222997 GAAAAACAAGAAATGGGGAAAGG - Intronic
978238636 4:106490167-106490189 GAAAAACAAGAAATGGGGAAAGG + Intergenic
979529998 4:121759981-121760003 GAAAATCCTGATGTGGGACAAGG + Exonic
979567057 4:122166333-122166355 CAAAATCAAGAAATGGGGAAAGG - Intronic
979896559 4:126165173-126165195 GAAAAACAAGAAATGGGGAAAGG - Intergenic
979964712 4:127063841-127063863 GAAAAACAAGAAATGGGGAAAGG - Intergenic
980000136 4:127477544-127477566 GAAAAACAAGAAATGGGGAAAGG + Intergenic
980781852 4:137501009-137501031 GAAAAACAAGAAATGGGGAAAGG + Intergenic
981109846 4:140922851-140922873 CAAAAACCAGAAATGGGGAAAGG + Intronic
981234957 4:142405094-142405116 TCAAATCCAGAGATGGGGCGGGG + Intronic
981325883 4:143447054-143447076 GAAAAACAAGAAATGGGGAAAGG - Intronic
981607356 4:146554193-146554215 GAAAATCAAGCAATGGGGAAAGG - Intergenic
982104007 4:151996153-151996175 GAAAATCTAAAGATTGGGGATGG - Intergenic
982117744 4:152112238-152112260 GTAAATCCAGAGCTGGGGGTGGG - Intergenic
982175837 4:152704706-152704728 GGAAGCCCAGAGCTGGGGCAAGG - Intronic
982508414 4:156249985-156250007 GAAGAGCCAGAGGTGGTGCAGGG - Intergenic
982511232 4:156285824-156285846 GAAAAACAAGAAATGGGGAAAGG - Intergenic
982836085 4:160121476-160121498 GAAAAACAAGAAATGGGGAAAGG - Intergenic
982944126 4:161597290-161597312 GAAAAACAAGAAATGGGGAAAGG - Intronic
982945645 4:161619071-161619093 GAAAAACAAGAAATGGGGAAAGG + Intronic
982960897 4:161835184-161835206 GAAAACCAAGAAATGGGGAAAGG + Intronic
983128153 4:163980248-163980270 GAAAAACAAGAAATGGGGAAAGG + Intronic
983947637 4:173604318-173604340 GAAAAACAAGAAATGGGGAAAGG - Intergenic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
984384242 4:179034797-179034819 CAAAAACCAGAAATGGGGAAAGG + Intergenic
984751287 4:183278237-183278259 GAAAAACAAGAAATGGGGAAAGG - Intronic
986118473 5:4804966-4804988 GAAAGTCAAGAGGTGGGGGATGG - Intergenic
986450293 5:7856702-7856724 GCAAATCCAGAGAGGGGTCTTGG - Intronic
986561311 5:9062914-9062936 GGTATTCCAGAGATGGGCCAAGG + Exonic
987200127 5:15568849-15568871 GAAAAACAAGAAATGGGGAAAGG - Intronic
987249023 5:16079942-16079964 GAAAATCCAGAGATGGGAAGGGG - Intronic
987366926 5:17157218-17157240 AAAACACAAGAGATGGGGCAAGG - Intronic
987753780 5:22074194-22074216 GAAAAACAAGAAATGGGGGAAGG + Intronic
987928052 5:24366865-24366887 GAAAACTCAGAGAGGGGACATGG - Intergenic
988412286 5:30902090-30902112 GAAAATCAAAAGATGAGGTAGGG + Intergenic
988629256 5:32911550-32911572 GAAAAACAAGAAATGGGGAAAGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
989254075 5:39347901-39347923 GAAAAACAAGAAATGGGGAAAGG + Intronic
989483818 5:41965143-41965165 GAAAAACAAGAAATGGGGAAAGG - Intergenic
989680118 5:44018601-44018623 GAAAAACAAGAAATGGGGAAAGG + Intergenic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
990166042 5:52994252-52994274 AAAAATCCAAACATGGGGAAAGG + Intronic
990676577 5:58193302-58193324 GAAAAACAAGAAATGGGGAAAGG + Intergenic
990685177 5:58292886-58292908 GAAAAACAAGAAATGGGGAAAGG + Intergenic
990882956 5:60560351-60560373 GAAAAACAAGAAATGGGGAAAGG + Intergenic
990924710 5:61007376-61007398 CAAAAACAAGAGATGGGGAAAGG - Intronic
991115647 5:62951564-62951586 GAAAAACAAGACATGGGGAAAGG - Intergenic
991144870 5:63289300-63289322 TTGATTCCAGAGATGGGGCACGG - Intergenic
991168038 5:63586654-63586676 GAAAAACAAGAAATGGGGAAAGG + Intergenic
991196741 5:63943088-63943110 GAAAAACAAGAAATGGGGAAAGG + Intergenic
991233098 5:64359895-64359917 GAAAAACAAGAAATGGGGAAAGG - Intronic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991401657 5:66258078-66258100 GAAAAACAAGAAATGGGGAAAGG - Intergenic
991535181 5:67662116-67662138 GAAAAACAAGAAATGGGGAAAGG - Intergenic
992028969 5:72701636-72701658 GAAAAACAAGAAATGGGGAAAGG - Intergenic
992183287 5:74219323-74219345 CAAAAACCAGAAATGGGGAAAGG + Intergenic
992526232 5:77613526-77613548 GAAAAACAAGAAATGGGGAAAGG + Intronic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
993399541 5:87431793-87431815 GAACTGCCAGACATGGGGCATGG + Intergenic
993578086 5:89626403-89626425 GAAAAACAAGAAATGGGGAAAGG + Intergenic
993818530 5:92584027-92584049 GAAAAACAAGAAATGGGGAAAGG + Intergenic
994479560 5:100316780-100316802 GAAAAACAAGAAATGGGGAAAGG + Intergenic
994571871 5:101525994-101526016 GAAAAACAAGAAATGGGGAAAGG - Intergenic
994576738 5:101588189-101588211 GAAAAACAAGAAATGGGGAAAGG + Intergenic
994693998 5:103051486-103051508 GAAAAACAAGAAATGGGGAAAGG + Intergenic
995087835 5:108135639-108135661 GAAAATCCAGAGAAAAGGCAGGG + Intronic
995384786 5:111576770-111576792 GAAAAACAAGAAATGGGGAAAGG - Intergenic
996171831 5:120303015-120303037 GAAAAACAAGAAATGGGGAAAGG - Intergenic
996474030 5:123894927-123894949 GAAAATCCAGACATTGGGCTGGG + Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
997095173 5:130902391-130902413 GAAAAACAAGAAATGGGGAAAGG + Intergenic
997274990 5:132578106-132578128 AAAAAATCAGAGATGGGGCTGGG - Intronic
997300999 5:132805099-132805121 CAAAAACCAGAAATGGGGAAAGG + Intronic
997414027 5:133711386-133711408 GGAAATCCAGAGAGGAGGGAAGG + Intergenic
997873669 5:137528545-137528567 GAAAAACAAGAAATGGGGAAAGG + Intronic
998242164 5:140456593-140456615 GAAAAGCAAGAAATGGGGAAAGG + Intronic
998348002 5:141481520-141481542 AAAAATCTAGAGATGGGGCTGGG + Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998784173 5:145690582-145690604 CAAAATCCAGAAATGGGTCCTGG + Intronic
999556247 5:152745686-152745708 GAAAAACCAGCAATGGGGAAAGG + Intergenic
999570526 5:152914935-152914957 GAAAAACAAGAAATGGGGAAAGG - Intergenic
999733944 5:154498674-154498696 GAAAGTCCTCAGAAGGGGCAGGG - Intergenic
999969827 5:156848275-156848297 GAAAATACAGAGTTAGGGCCAGG + Intergenic
1000006871 5:157193733-157193755 GAAAAGGCAGAGTTGGGGCAAGG + Intronic
1000203651 5:159036536-159036558 GAAAAACAAGAAATGGGGAAAGG + Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000566644 5:162856180-162856202 GAAAAACCAGCAATGGGGAAAGG - Intergenic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1000835291 5:166145953-166145975 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1001351096 5:170965658-170965680 GAAAAACAAGAAATGGGGAAAGG - Intronic
1001360903 5:171085222-171085244 GAAAAACAAGAAATGGGGAAAGG - Intronic
1001771246 5:174298028-174298050 CAAAAACAAGAAATGGGGCAAGG - Intergenic
1002394226 5:178940874-178940896 GAAAAGCTGAAGATGGGGCAAGG - Intergenic
1002653069 5:180718075-180718097 CACAAAACAGAGATGGGGCAGGG + Intergenic
1003114581 6:3275198-3275220 GCAAATCCAGTGAGGGGGAAGGG + Intronic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004095904 6:12554063-12554085 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1004295398 6:14405493-14405515 GAAAATGCAGACATGGCGTAGGG + Intergenic
1004443921 6:15680336-15680358 AAAAGGTCAGAGATGGGGCATGG - Intergenic
1005726787 6:28657114-28657136 GACAATGCAGAGATGCGGTAAGG - Intergenic
1007560750 6:42806319-42806341 GAATCTCCAGGGTTGGGGCAGGG + Intronic
1007981485 6:46163827-46163849 GAAAAACAAGAAATGGGGAAAGG + Intronic
1008398095 6:51032656-51032678 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1008634940 6:53401319-53401341 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1008829478 6:55740404-55740426 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1008958089 6:57237675-57237697 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1009579597 6:65514671-65514693 GAAAAACAAGTGATGGGGAAAGG + Intronic
1009704349 6:67226519-67226541 GAAAATTCAGAGTTGGAGAAGGG - Intergenic
1010166403 6:72919937-72919959 TACAATCCAGAGCTGGGGCCTGG + Intronic
1010251850 6:73715270-73715292 AAAAAACCAGTGATGAGGCACGG + Intronic
1010320046 6:74496415-74496437 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1010441388 6:75899084-75899106 GTAACTCCAGAGATGGGGGTGGG + Intronic
1010582300 6:77614756-77614778 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1010675590 6:78739132-78739154 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1010675794 6:78741445-78741467 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1010852761 6:80798335-80798357 GAAAATGGAGAGGTGGGGCCAGG - Intergenic
1010883501 6:81209192-81209214 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1011065126 6:83318033-83318055 GAAAAACAAGAAATGGGGAAAGG + Intronic
1011147838 6:84238377-84238399 CAAAATCAAGCGATGGGGAAAGG + Intergenic
1011776347 6:90734998-90735020 CAAAAACAAGAAATGGGGCAAGG - Intergenic
1012081421 6:94762639-94762661 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1012821510 6:104090304-104090326 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1012971005 6:105730720-105730742 AAAAAGCCAGGCATGGGGCATGG + Intergenic
1013197942 6:107862404-107862426 GATGATACAGAGCTGGGGCAGGG - Intergenic
1014306403 6:119747999-119748021 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1014675470 6:124359032-124359054 GAAAAACAAGAAATGGGGAAAGG - Intronic
1014850692 6:126336682-126336704 TAAATTCCTGAGATGGTGCATGG + Intergenic
1014907547 6:127048116-127048138 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1015107966 6:129559048-129559070 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1015976245 6:138794257-138794279 GAAAATCCAGAGAGCTGGAAAGG - Intergenic
1016134379 6:140520726-140520748 TAAAAACAAGAGATGAGGCAGGG - Intergenic
1016370039 6:143364361-143364383 AAAAATCCAGAACAGGGGCAGGG + Intergenic
1016718596 6:147265642-147265664 GAAAATACTGAGGTGGGGCCTGG + Intronic
1017226978 6:152033022-152033044 GAAAAACAAGAAATGGGGAAAGG + Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1018073324 6:160186258-160186280 GAAAAACAAGAAATGGGGAAAGG + Intronic
1018939739 6:168301247-168301269 GAAGTTCCAGAGAAGGGGCCTGG - Intronic
1019901726 7:4026221-4026243 GAGAATGCAGAGACAGGGCATGG + Intronic
1020761097 7:12269250-12269272 GAAAATGCAGACAGGAGGCATGG + Intergenic
1020953412 7:14708696-14708718 GAAAAACAAGAAATGGGGAAAGG + Intronic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1021766236 7:23952042-23952064 GAAAATCAAGCAATGGGGAAAGG + Intergenic
1021859272 7:24890006-24890028 GCAAATCCCTAGATGGGTCAGGG + Intronic
1022334759 7:29411837-29411859 GAACATCCAGAGACGGGGGCGGG - Intronic
1022496280 7:30855026-30855048 GAAAAACCAGAGCTGGGGACAGG - Intronic
1023228465 7:37997726-37997748 GAAAAACAAGAAATGGGGAAAGG - Intronic
1023455570 7:40335012-40335034 GAAAAACAAGAAATGGGGAAAGG - Intronic
1023501488 7:40854757-40854779 AAAAATCTAGAGATGGGGACTGG - Intronic
1024105934 7:46086624-46086646 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1024129648 7:46337575-46337597 CAAAAACTAGAAATGGGGCAAGG - Intergenic
1024380439 7:48689809-48689831 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1025651215 7:63471230-63471252 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1026936358 7:74258502-74258524 GAAAAACCATAAATGGGGCTGGG - Intergenic
1028013260 7:85676204-85676226 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1028201975 7:87972824-87972846 GAAAAACCAGCAATGGGGAAAGG + Intronic
1028205108 7:88007630-88007652 GAAAAACCAGCAATGGGGAAAGG + Intronic
1028211732 7:88082218-88082240 GAAAAACCAGCAATGGGGAAAGG + Intronic
1028766917 7:94570106-94570128 GAAAAGTCAGAGATTGGGCCAGG - Intergenic
1028810354 7:95079241-95079263 GAAAAACAAGAAATGGGGAAAGG - Intronic
1029010738 7:97259327-97259349 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1029341876 7:99951714-99951736 GAATAACCAGGGATGGGGCCTGG + Intergenic
1029447472 7:100621885-100621907 AACAAACCAGAGATGGGGCTAGG - Intronic
1029691214 7:102183307-102183329 AAAAATTAAGAGATGGGGCCGGG - Intronic
1030220588 7:107094767-107094789 GAAAAACAAGAAATGGGGAAAGG - Intronic
1030492375 7:110254148-110254170 GAAAAGGCAGAAATGAGGCATGG - Intergenic
1030501776 7:110368309-110368331 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1030966004 7:115994087-115994109 CAAAAACCAGAAATGGGGGAAGG + Intronic
1032290145 7:130582228-130582250 GAAAAACAAGAAATGGGGAAAGG + Intronic
1032911934 7:136442582-136442604 AAAAATTCAGAGGTGGGGCATGG + Intergenic
1033014771 7:137661188-137661210 GAATCACCAGAGATGGGACATGG + Intronic
1033083272 7:138318575-138318597 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1033624281 7:143093153-143093175 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1033723507 7:144086710-144086732 GAAAACACAGAGATGCGGAAAGG - Intergenic
1033793668 7:144822206-144822228 AAAAATCCAGAAATTGGGGAAGG - Intronic
1034513974 7:151559421-151559443 GAAACTCTAGAAATGGGGCCTGG - Intronic
1034983329 7:155491849-155491871 GAAAATGCTGAGAGGGGGGAAGG + Intronic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1036113360 8:5931019-5931041 GAAAAACAAGCAATGGGGCAAGG + Intergenic
1036978488 8:13442085-13442107 GAAAAACAAGAAATGGGGAAAGG + Intronic
1037637307 8:20711520-20711542 GAAGAGGCAGAGGTGGGGCATGG + Intergenic
1038050842 8:23809513-23809535 GAGAGTACAGAGATGGTGCAAGG + Intergenic
1038225777 8:25656194-25656216 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1038288093 8:26224291-26224313 AAAAATCCAGAAAAGGGGCTGGG + Intergenic
1038929399 8:32176209-32176231 GAAAAACAAGAAATGGGGAAAGG + Intronic
1039003773 8:33011021-33011043 GTAAATTCAGAGATGGGGGTGGG - Intergenic
1039247211 8:35622046-35622068 TAAAATCCTGAGAGGGGGCCGGG + Intronic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1040274568 8:46001351-46001373 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1040521844 8:48183776-48183798 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1040524698 8:48210747-48210769 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041387770 8:57322207-57322229 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1041470227 8:58199828-58199850 GAAAAACAAGAAATGGGGAAAGG - Intronic
1041478147 8:58288221-58288243 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1041513959 8:58679429-58679451 GTAAATAGAGAGATGAGGCATGG + Intergenic
1041841703 8:62279633-62279655 GAAAAACAAGAAATGGGGAAAGG - Intronic
1041870684 8:62631327-62631349 GAAATATCAGAGATGGGGCAGGG - Intronic
1041885746 8:62805533-62805555 GAAAAACAAGAAATGGGGAAAGG + Intronic
1042023801 8:64401112-64401134 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1042402584 8:68366629-68366651 GAAAAACAAGAAATGGGGAAAGG + Intronic
1042458748 8:69037402-69037424 GAAAAACAAGACATGGGGAAAGG - Intergenic
1042597106 8:70461482-70461504 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1042884264 8:73530667-73530689 GAAAATACAGAAATTGGGCTTGG + Intronic
1042914530 8:73862416-73862438 GAAAAACAAGAAATGGGGAAAGG - Intronic
1043171743 8:76974219-76974241 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1043175996 8:77024083-77024105 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1043178079 8:77046997-77047019 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1043378771 8:79680383-79680405 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1043592936 8:81850912-81850934 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1043725566 8:83606299-83606321 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1043797968 8:84569307-84569329 GAAAAACAAGAAATGGGGAAAGG - Intronic
1043806728 8:84681110-84681132 CAAAATCAAGAAATGGGGAAAGG - Intronic
1043828018 8:84952685-84952707 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1043845275 8:85156152-85156174 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1044041780 8:87378413-87378435 GAAAAACAAGAAATGGGGAAAGG - Intronic
1044054721 8:87554522-87554544 GAAAAACAAGAAATGGGGAAAGG - Intronic
1044403448 8:91798291-91798313 GAAAAACAAGCAATGGGGCAGGG + Intergenic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1045069653 8:98488740-98488762 GAAAATGCAGAGAAGTGGTATGG + Intronic
1045439739 8:102197680-102197702 CAAAGGCCAGAGATGGGGAATGG + Intergenic
1045585344 8:103528651-103528673 CAAAAACAAGAAATGGGGCAAGG - Intronic
1045874547 8:106963815-106963837 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1045979766 8:108171130-108171152 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1046203428 8:110956362-110956384 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1046322673 8:112598750-112598772 GAAAAACAAGAAATGGGGAAAGG + Intronic
1046638195 8:116696163-116696185 CTGAATCCAGAGATGGGACAGGG + Intronic
1046663433 8:116973920-116973942 CAAAAACAAGAAATGGGGCAAGG + Intronic
1046706297 8:117456156-117456178 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1046708199 8:117479012-117479034 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1046813057 8:118553413-118553435 GAAAAACAAGAAATGGGGAAAGG + Intronic
1047010183 8:120663768-120663790 GAGAAGACAGAGACGGGGCAAGG + Intronic
1047065591 8:121278514-121278536 GAAAAACAAGAAATGGGGGAAGG - Intergenic
1047693527 8:127380839-127380861 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1047920320 8:129628584-129628606 GAAAAGCAAGAGCTGTGGCACGG - Intergenic
1047962742 8:130022802-130022824 AAAAATCAAGAGAGGGGGCTGGG + Intergenic
1048093713 8:131268074-131268096 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1048156937 8:131964947-131964969 GAAAAACAAGAAATGGGGAAAGG + Intronic
1048198378 8:132351420-132351442 GAAATTAGAGAGTTGGGGCAGGG - Intronic
1048228934 8:132618178-132618200 GAAAAACAAGAAATGGGGAAAGG + Intronic
1048774892 8:137934886-137934908 GAAAAGCCAGAGCTGGGCCACGG + Intergenic
1049455084 8:142682604-142682626 GAGTCTCCAGAGATGGGGCCTGG + Exonic
1051349824 9:16188531-16188553 CAAAAACAAGAAATGGGGCAAGG - Intergenic
1051418039 9:16863206-16863228 GAATATATTGAGATGGGGCAGGG - Intronic
1051959067 9:22736051-22736073 GAAAATCAAGCAATGGGGAAAGG - Intergenic
1052078321 9:24172852-24172874 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1052101547 9:24452510-24452532 GAAAATGCAGATATTAGGCATGG + Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052123805 9:24751681-24751703 GAAAAACAAGAAATGGGGGAAGG - Intergenic
1052145268 9:25041228-25041250 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1052465394 9:28822862-28822884 TAAAATCCAGAGATGGCACTGGG + Intergenic
1052554563 9:29997677-29997699 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1052685571 9:31751096-31751118 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1052696386 9:31884417-31884439 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1053148202 9:35726302-35726324 CAAATTCCAGTGGTGGGGCAGGG - Intronic
1053686819 9:40537609-40537631 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1054276904 9:63088059-63088081 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1054358731 9:64091463-64091485 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1054397933 9:64676871-64676893 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1054432573 9:65182065-65182087 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1054497812 9:65839611-65839633 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1054775589 9:69121433-69121455 AAAAATCCAGGGTGGGGGCAGGG - Intronic
1055491290 9:76807701-76807723 GAAAACCCAGAGCTGGGACCAGG + Intronic
1055859181 9:80727919-80727941 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1055918940 9:81437161-81437183 GAAAAGCAAGAAATGGGGAAAGG + Intergenic
1056218407 9:84427465-84427487 GAACATACAGAGGTTGGGCAAGG - Intergenic
1057693263 9:97306053-97306075 AAAAAGCCAGAGATAGGGAACGG - Intergenic
1058490185 9:105490765-105490787 GAAAAACAAGAAATGGGGAAAGG - Intronic
1058497633 9:105577428-105577450 GAAAAACAAGAAATGGGGAAAGG - Intronic
1058512301 9:105732568-105732590 GAAAAACAAGAAATGGGGAAAGG - Intronic
1059361482 9:113745225-113745247 GGAAATCCCAGGATGGGGCAGGG - Intergenic
1059658104 9:116374763-116374785 CAAAATCCAGAGATGTTGGAGGG - Intronic
1059732112 9:117067266-117067288 GAAAAACAAGAAATGGGGAAAGG - Intronic
1059900788 9:118922637-118922659 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1060667609 9:125441830-125441852 TAAAAATCAGAGATGGGGCCGGG + Intronic
1060823494 9:126674434-126674456 GAACAGGCAGAGATGGGGCCTGG + Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1061255791 9:129453736-129453758 GAAGATGGAGAGATGGGGAATGG + Intergenic
1062332452 9:136050725-136050747 GACACTCCAGAGAAGGGACACGG + Intronic
1062461393 9:136663992-136664014 GCAGATCCAGAGATGAGGCCAGG + Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1202785846 9_KI270719v1_random:18001-18023 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1203410740 Un_KI270581v1:6656-6678 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1203711271 Un_KI270742v1:100010-100032 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1186595478 X:10976693-10976715 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1187425255 X:19171858-19171880 TAAAAAGCAGAGATGGGGCCTGG + Intergenic
1187589729 X:20704264-20704286 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1188135601 X:26491023-26491045 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1188203595 X:27323165-27323187 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1188605338 X:32022154-32022176 AAAAATCCAGAAAAGGGGCCTGG + Intronic
1189074213 X:37898858-37898880 CAGAAACCAGAGATGGGACATGG + Intronic
1189347421 X:40252589-40252611 CCAAAGCCAGAGTTGGGGCAAGG + Intergenic
1189603887 X:42655575-42655597 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1190374975 X:49780202-49780224 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1190478808 X:50854119-50854141 GGAAATGAAGAGATGGGGAAGGG - Intergenic
1190604235 X:52124031-52124053 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1190624311 X:52321795-52321817 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1190790954 X:53699550-53699572 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1190940034 X:55031136-55031158 GAAGAGCCAGAGCTGGGGGAGGG - Intergenic
1191028924 X:55946367-55946389 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1191040810 X:56077401-56077423 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1191168779 X:57419978-57420000 GAAAAACCAGAAATGGGGAAAGG - Intronic
1191589093 X:62861003-62861025 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1191758208 X:64617838-64617860 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1191804498 X:65119906-65119928 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1191809095 X:65167302-65167324 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1192132081 X:68561036-68561058 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192842745 X:74874252-74874274 GAAAAACAAGAAATGGGGAAAGG - Intronic
1192905352 X:75545011-75545033 GAAAATCCAGATCTGGGAGAAGG - Intergenic
1192912641 X:75621256-75621278 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1192978718 X:76316004-76316026 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1193033945 X:76929233-76929255 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1193163891 X:78259903-78259925 GAAAAACAAGCGATGGGGAAAGG - Intergenic
1193215156 X:78855231-78855253 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1193228604 X:79015235-79015257 GAAAATCAAGCAATGGGGAAAGG - Intergenic
1193344058 X:80385303-80385325 GAAAAACAAGAAATGGGGAAAGG + Intronic
1193875329 X:86855599-86855621 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1194221180 X:91193453-91193475 AAAAATCAAGAAATGGGGAAAGG + Intergenic
1194254420 X:91619131-91619153 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1194612003 X:96056011-96056033 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1194987056 X:100502184-100502206 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1195132492 X:101867511-101867533 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1195132644 X:101869295-101869317 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1195147918 X:102036311-102036333 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1195170977 X:102268171-102268193 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1195187883 X:102418928-102418950 GAAAAACAAGAAATGGGGAAAGG - Intronic
1195261492 X:103136264-103136286 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1195586586 X:106571947-106571969 CAAAATCAAGCAATGGGGCATGG + Intergenic
1195867255 X:109446506-109446528 CAAAATCAAGAAATGGGGAAAGG + Intronic
1195970534 X:110468356-110468378 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1196147167 X:112330888-112330910 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1196156193 X:112432991-112433013 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1196383426 X:115119901-115119923 GAAAAACAAGAAATGGGGAAAGG + Intronic
1196536578 X:116852227-116852249 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1196562622 X:117168708-117168730 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1196620890 X:117822282-117822304 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1196638939 X:118036474-118036496 GAAAAACAAGAAATGGGGAAAGG + Intronic
1196712720 X:118780111-118780133 AAAATTCCAGATATGGGGAAGGG + Intronic
1197367843 X:125587655-125587677 AAAAATACAGAGATGTGGGAGGG - Intergenic
1197475275 X:126915191-126915213 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1197538416 X:127723008-127723030 GAAAATCCAGACATAAGGGAAGG - Intergenic
1197544099 X:127802554-127802576 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1197575297 X:128203806-128203828 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1197644345 X:129001911-129001933 TAAAAACAAGAAATGGGGCAAGG + Intergenic
1197646478 X:129023357-129023379 AAAAATCAAGAAATGGGGAAAGG + Intergenic
1197915433 X:131529349-131529371 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1197973277 X:132137477-132137499 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1198044005 X:132881884-132881906 CAAAAACCAGAAATGGGGAAGGG - Intronic
1198484757 X:137075982-137076004 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1198553216 X:137766192-137766214 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1198887752 X:141357864-141357886 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1199789801 X:151142159-151142181 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1199906446 X:152237255-152237277 GAAAAACAAGAAATGGGGAAAGG - Intronic
1199922012 X:152416756-152416778 GAAAAACAAGAAATGGGGAAAGG + Intronic
1200382436 X:155852904-155852926 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1200405506 Y:2806822-2806844 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1200447049 Y:3275963-3275985 GAAAAACAAGAAATGGGGAAAGG + Intergenic
1200870949 Y:8097722-8097744 GAAAAACAAGAAATGGGGAAAGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201506226 Y:14703420-14703442 GAAAAACCAGCAATGGGGAAAGG - Intronic
1201527049 Y:14947985-14948007 GAAAAACAAGGGATGGGGAAAGG - Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic