ID: 922406956

View in Genome Browser
Species Human (GRCh38)
Location 1:225324091-225324113
Sequence TAGGCATGAGCCGCCGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120134
Summary {0: 1, 1: 37, 2: 1673, 3: 21509, 4: 96914}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922406955_922406956 -6 Left 922406955 1:225324074-225324096 CCAAAGTGCTGGGTTTATAGGCA 0: 80
1: 11361
2: 115881
3: 246138
4: 241323
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406946_922406956 11 Left 922406946 1:225324057-225324079 CCACCCACCTCGACCTCCCAAAG 0: 972
1: 31105
2: 117173
3: 161521
4: 169093
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406948_922406956 7 Left 922406948 1:225324061-225324083 CCACCTCGACCTCCCAAAGTGCT 0: 2438
1: 95371
2: 188205
3: 135654
4: 71168
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406945_922406956 12 Left 922406945 1:225324056-225324078 CCCACCCACCTCGACCTCCCAAA 0: 20
1: 447
2: 2030
3: 4607
4: 6735
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406950_922406956 4 Left 922406950 1:225324064-225324086 CCTCGACCTCCCAAAGTGCTGGG 0: 3341
1: 124982
2: 268208
3: 211109
4: 126311
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406954_922406956 -5 Left 922406954 1:225324073-225324095 CCCAAAGTGCTGGGTTTATAGGC 0: 126
1: 21788
2: 250515
3: 272843
4: 172909
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406952_922406956 -2 Left 922406952 1:225324070-225324092 CCTCCCAAAGTGCTGGGTTTATA 0: 172
1: 28393
2: 326154
3: 258281
4: 140769
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406944_922406956 22 Left 922406944 1:225324046-225324068 CCTCTGGTGACCCACCCACCTCG 0: 1
1: 213
2: 7036
3: 29111
4: 60346
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406943_922406956 27 Left 922406943 1:225324041-225324063 CCTGACCTCTGGTGACCCACCCA 0: 5
1: 544
2: 17088
3: 45954
4: 81626
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914
922406947_922406956 8 Left 922406947 1:225324060-225324082 CCCACCTCGACCTCCCAAAGTGC 0: 1283
1: 42676
2: 192034
3: 269723
4: 180375
Right 922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG 0: 1
1: 37
2: 1673
3: 21509
4: 96914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922406956 Original CRISPR TAGGCATGAGCCGCCGCCCC CGG Intronic
Too many off-targets to display for this crispr