ID: 922407326

View in Genome Browser
Species Human (GRCh38)
Location 1:225328761-225328783
Sequence TACTTACATATTAACGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407326_922407333 27 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407326_922407330 1 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407326_922407332 26 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407326_922407331 15 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407326 Original CRISPR TACTTACATATTAACGCATG GGG (reversed) Intronic
906830372 1:49024943-49024965 TACTTACATTTTAACTAATAGGG + Intronic
908692644 1:66800098-66800120 TAATTCCATATTAAAGTATGAGG - Intronic
909377547 1:74957366-74957388 TATTTAAATATTAATGCATCTGG - Intergenic
911770429 1:101733884-101733906 TTCTCACACATTAAGGCATGTGG + Intergenic
912730746 1:112100915-112100937 TACCAATATATTAACCCATGCGG + Intergenic
913124225 1:115770460-115770482 TACTTACATATTAAGAAAAGTGG - Intergenic
914684128 1:149963089-149963111 TACTTACATATTAAATCTTCAGG + Intronic
916411263 1:164549327-164549349 TACTTACAAAGTAAGGCATTTGG - Intergenic
919791721 1:201295293-201295315 TTCTTACATATTACAGCTTGGGG + Intronic
922407326 1:225328761-225328783 TACTTACATATTAACGCATGGGG - Intronic
924324200 1:242878937-242878959 TCCTTACATATTATAGCATGTGG + Intergenic
924618990 1:245643618-245643640 AAATTACATATTTACCCATGTGG + Intronic
1066143780 10:32535289-32535311 TAATTACCTATTAAGGCATTAGG - Intronic
1066964553 10:42250397-42250419 TACTTACTTATTTACTCAAGAGG + Intergenic
1072127981 10:92464501-92464523 TACTTCCATGTTATCTCATGAGG + Intronic
1072130574 10:92490241-92490263 TAGTTACATTTTATGGCATGAGG + Intronic
1073761568 10:106634360-106634382 TTCTTACATATTATCTCATGTGG + Intronic
1073907633 10:108302129-108302151 TACCTACATATTAAAGCCAGAGG - Intergenic
1079615917 11:22492767-22492789 TACTTCCATATTTACTGATGAGG - Intergenic
1086013306 11:82132308-82132330 TACTTACAAATTTACGCACATGG - Intergenic
1086372378 11:86168109-86168131 TAGTTGCATGTTAATGCATGTGG - Intergenic
1090118411 11:123999087-123999109 CACTTACTTATAAAAGCATGGGG + Intergenic
1095639007 12:44465831-44465853 TACTCACATATTAAGGCTTGAGG + Intergenic
1096097198 12:48943546-48943568 TATTTACAAGCTAACGCATGGGG + Intronic
1098506733 12:71261020-71261042 TAGTTAAATATTAATGCCTGTGG - Intronic
1100624307 12:96315202-96315224 TATTTACATATAAAATCATGAGG + Intronic
1102151832 12:110694067-110694089 TACTTACTTATTTAGGGATGGGG + Intronic
1109492095 13:63114975-63114997 TAATAGCATATTAAGGCATGTGG - Intergenic
1111025983 13:82525142-82525164 TAAGTACATATTAAAGCATCAGG - Intergenic
1111554654 13:89864756-89864778 TACTTACATACTAACACATAAGG - Intergenic
1112739855 13:102460409-102460431 CGTTTACATATTAATGCATGTGG - Intergenic
1136730244 16:32404390-32404412 TACTTACTTATTTACTCAAGAGG + Intergenic
1149464579 17:56867101-56867123 TACATATATATTTACCCATGTGG + Exonic
1168237116 19:55070533-55070555 TACTTACATATTAAATAATGAGG - Intronic
925773396 2:7306914-7306936 TACTTAAATATTATAGGATGAGG - Intergenic
930144836 2:47991401-47991423 TACTTACAAAATAAGGCAGGGGG + Intergenic
932800962 2:74742065-74742087 TACTTACTTATAAATACATGAGG - Intergenic
934315470 2:91914786-91914808 TACTTACTTATTTACTCAAGAGG - Intergenic
940552483 2:155178653-155178675 AATTTACATATTAAGGCATATGG + Intergenic
941522164 2:166559537-166559559 TTCTTAAATATTAATTCATGTGG - Intergenic
942716924 2:178903691-178903713 TAGTTACATATGTATGCATGTGG - Intronic
943137598 2:183934891-183934913 TACTAACATATTTATTCATGTGG + Intergenic
1171762323 20:29217101-29217123 TAGTTACATATGTATGCATGTGG - Intergenic
1176997220 21:15569743-15569765 CACTTACACATGAAAGCATGTGG - Intergenic
1178238564 21:30872542-30872564 TACTTACATAGTAACTCATTCGG + Intergenic
1180411246 22:12611484-12611506 TACTTACATATGTATACATGTGG + Intergenic
1180542241 22:16460671-16460693 TACTTACTTATTTACTCAAGAGG - Intergenic
1182933588 22:34198173-34198195 TACTTACAGAGTAACGGATATGG - Intergenic
1183666179 22:39247334-39247356 TTCCCACATATTAATGCATGTGG - Intergenic
951488425 3:23240912-23240934 TACTTATATATTAACACTTAAGG + Intronic
956447392 3:69338981-69339003 TGCTTGGATATTAACCCATGAGG - Intronic
957911381 3:86623681-86623703 TACTTATATATTAACACTTCTGG + Intergenic
961816592 3:129553885-129553907 TACTGACATATTGTCGCATGGGG + Intergenic
970230999 4:13911187-13911209 TACTTACACATTATCTCATTTGG - Intergenic
970383008 4:15527012-15527034 TATTTACATTTTAAAACATGTGG - Intronic
974438052 4:61882350-61882372 TACATACATAATACAGCATGGGG - Intronic
974641921 4:64642226-64642248 TACTTAAATATTTACCCATTTGG - Intergenic
977947711 4:102932865-102932887 TACTTACTTATTTACTCAAGAGG - Intronic
978417327 4:108490266-108490288 TAATTACAAAGTAATGCATGAGG - Intergenic
979617176 4:122756688-122756710 TATTTAAATATTAATTCATGTGG - Intergenic
981511621 4:145564632-145564654 TACTGACATAGTAACATATGGGG - Intergenic
982919226 4:161252755-161252777 TACTTTCATATTAACGTTTCTGG - Intergenic
984728385 4:183042740-183042762 TACTTACAAATGAGAGCATGAGG + Intergenic
985756536 5:1722843-1722865 TACTTACATATGAGCACAGGTGG - Intergenic
986130771 5:4927938-4927960 TACTTACCTATTAATGAATCTGG - Intergenic
990041362 5:51382272-51382294 AAATTATATATTAACGCCTGGGG + Intergenic
991271611 5:64790045-64790067 TAATTACATTTTAATGCAAGGGG - Intronic
995030816 5:107479270-107479292 TGCTTACATATTTACCCCTGGGG - Intronic
995105978 5:108379187-108379209 TACTTACAAATTATTTCATGAGG - Intronic
996003349 5:118389727-118389749 TACTTACATATTGATACAGGTGG - Intergenic
996971559 5:129375063-129375085 AACTTCCATATTAATGCATAAGG - Intergenic
999362943 5:151001356-151001378 TACTTACATATCAGCGAAGGAGG - Intergenic
1001257325 5:170193810-170193832 TCCTGACATATTAACAAATGAGG + Intergenic
1005286382 6:24332056-24332078 TACTGACATCTAAAGGCATGCGG + Intronic
1009830582 6:68926875-68926897 TACTTACATATTCCTGGATGGGG + Intronic
1010696953 6:78987726-78987748 TACTGAAATAATGACGCATGAGG + Intronic
1012596345 6:101045905-101045927 TTCTTACAGAATAAGGCATGGGG - Intergenic
1012999662 6:106009554-106009576 TACCTACATATATACACATGGGG + Intergenic
1014699773 6:124670111-124670133 TAGTTACATAGTAATGCATTTGG - Intronic
1020768568 7:12357719-12357741 TACTTTCATAATAATGCCTGAGG - Intronic
1024202288 7:47119699-47119721 TACTTTCATAATACGGCATGTGG + Intergenic
1028403460 7:90449468-90449490 TAATTTCATATTTATGCATGTGG + Intronic
1028509910 7:91612756-91612778 TGCTTCCATATTCACTCATGTGG - Intergenic
1028784640 7:94778028-94778050 GACTTAAATATGAACGGATGTGG - Intergenic
1031789903 7:126089151-126089173 TACTTCCATTTTATCACATGTGG + Intergenic
1032504224 7:132423831-132423853 TACTCACATAGCAACACATGGGG + Intronic
1050459715 9:5867232-5867254 TACATACAAATTAACTCATTTGG - Intergenic
1185975260 X:4713288-4713310 TACTTACATATTTACAAATAAGG + Intergenic
1189485673 X:41429628-41429650 TACTTACTAATTAAAGCCTGTGG + Intergenic
1194182983 X:90736482-90736504 TACATACATATTAACGTAGAGGG + Intergenic
1194385323 X:93245551-93245573 AACTTACATATGAAAGCATTTGG + Intergenic
1201183138 Y:11369608-11369630 TACTTACTTATTTACTCAAGAGG - Intergenic