ID: 922407327

View in Genome Browser
Species Human (GRCh38)
Location 1:225328762-225328784
Sequence TTACTTACATATTAACGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407327_922407330 0 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407327_922407331 14 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data
922407327_922407333 26 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407327_922407332 25 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407327 Original CRISPR TTACTTACATATTAACGCAT GGG (reversed) Intronic
No off target data available for this crispr