ID: 922407328

View in Genome Browser
Species Human (GRCh38)
Location 1:225328763-225328785
Sequence GTTACTTACATATTAACGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407328_922407330 -1 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407328_922407332 24 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407328_922407331 13 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data
922407328_922407333 25 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407328 Original CRISPR GTTACTTACATATTAACGCA TGG (reversed) Intronic