ID: 922407328

View in Genome Browser
Species Human (GRCh38)
Location 1:225328763-225328785
Sequence GTTACTTACATATTAACGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407328_922407333 25 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407328_922407330 -1 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407328_922407332 24 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407328_922407331 13 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407328 Original CRISPR GTTACTTACATATTAACGCA TGG (reversed) Intronic
900855766 1:5181978-5182000 GTTAGTTACATATGTACACATGG + Intergenic
907080186 1:51614802-51614824 GTTACTCACATTTTAAAGAAGGG + Intronic
907134458 1:52126204-52126226 GTTATTTACATAGTGATGCATGG + Intergenic
915061479 1:153189562-153189584 GTTACTTACATATAAAAAGATGG - Intergenic
921503745 1:215940394-215940416 GTAACTTAAATATTAATACAGGG - Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923206496 1:231764007-231764029 CTTATTTATATATTAACACAGGG - Intronic
1065053895 10:21823621-21823643 TTTACTTACATATAAACCAAGGG + Intronic
1065989276 10:30991962-30991984 GATACTTTCATATTAAAGCCTGG - Intronic
1074062134 10:109976278-109976300 GTTTCTTACATTTTAAAACAAGG + Intergenic
1075775910 10:124987599-124987621 GTTACTGACCTATTACCCCAGGG - Exonic
1090350545 11:126105094-126105116 GTTATTTACATAATAATACAGGG - Intergenic
1094157689 12:27354687-27354709 GTGACTTCCATATTTACGCTTGG + Intronic
1100717397 12:97320557-97320579 ATTACTTACATATTGAGACATGG + Intergenic
1101249279 12:102916366-102916388 GTGACCTACATATTTACCCATGG - Intronic
1111507384 13:89211009-89211031 GTTACTTTCAAATCAATGCAAGG - Intergenic
1117767043 14:59093995-59094017 GTTAATTAAATATTACCGCAGGG + Intergenic
1120548713 14:85843205-85843227 GTAACTTACATATAATCCCAAGG - Intergenic
1147589450 17:41672313-41672335 TTTACTTACATAGAAACCCAGGG - Intergenic
1149963983 17:61143342-61143364 TATACTTTCATATTAAGGCAGGG + Intronic
926600064 2:14832721-14832743 GTTACATGCATATTATTGCATGG + Intergenic
927431900 2:23033692-23033714 GGTATTTAAATATTAACACATGG + Intergenic
928808347 2:35189989-35190011 GTTATTTACTTATTTACACACGG - Intergenic
930144834 2:47991399-47991421 ATTACTTACAAAATAAGGCAGGG + Intergenic
940824043 2:158389953-158389975 GGTACATACATATTGAAGCATGG - Intronic
945744160 2:213700541-213700563 GTTACTTACATCTTAATGAAGGG + Intronic
1168819771 20:765034-765056 ATTACTTACATACATACGCATGG - Intronic
1169549127 20:6684155-6684177 ATTACTTACATAATAACTAAGGG - Intergenic
951783571 3:26391862-26391884 GATACATACATTTTAACCCACGG + Intergenic
957280836 3:78149447-78149469 TTTGCTTACATATAAACCCAGGG - Intergenic
957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG + Intergenic
960308979 3:116097592-116097614 ATTACTTACTTATTTACTCATGG - Intronic
961816590 3:129553883-129553905 GTTACTGACATATTGTCGCATGG + Intergenic
965440544 3:168707681-168707703 GTTACTTGTATTTTTACGCAGGG - Intergenic
966640310 3:182182497-182182519 CTTACTTACATATTTACAGAAGG + Intergenic
967315423 3:188148340-188148362 GTTATTTTCATATTAATGGAGGG + Intergenic
967791491 3:193553873-193553895 GTTATTTACATATTAATTCCAGG + Intronic
968459081 4:714872-714894 GTTACTGACATACTGACCCATGG - Intronic
969932946 4:10649840-10649862 ATTTCTTACAAATTAACCCATGG - Intronic
971882984 4:32405949-32405971 TTTACCAACATATTAACGTATGG - Intergenic
976501088 4:85789886-85789908 CTTACTTAGATCTTAAAGCAAGG - Intronic
977977157 4:103279178-103279200 GTTAGTTACATATGTACACATGG + Intergenic
980538592 4:134163293-134163315 GTTTCTTCCAGATTAAAGCAAGG - Intergenic
981100768 4:140826801-140826823 GTTTCTAACATATTCAAGCACGG + Intergenic
982541971 4:156684186-156684208 GATACTGACACATTAATGCAGGG + Intergenic
991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG + Intronic
991271613 5:64790047-64790069 TTTAATTACATTTTAATGCAAGG - Intronic
992171317 5:74104808-74104830 ATTACTTACATATTAATGGATGG - Intergenic
994709033 5:103243576-103243598 GGTACTTACATTTTAAGACATGG - Intergenic
994915641 5:105974397-105974419 GTTACTTCCATCCTAACGCCAGG - Intergenic
995644950 5:114301111-114301133 GTTATTTACATAGTAATGTAAGG - Intergenic
999009237 5:148016861-148016883 GGTAATTACATATTAATACAAGG - Intergenic
1000267706 5:159653556-159653578 GTTACCTACCTATAAACCCAAGG - Intergenic
1004566227 6:16800402-16800424 GTTAATTTCATATTAATGCAGGG + Intergenic
1005429921 6:25745057-25745079 GTCACTTACACATTAACTAATGG - Intergenic
1007974035 6:46082380-46082402 CTGACTTACATTTTAACGGAAGG - Intergenic
1008036545 6:46751605-46751627 CTTACTTACTTACTAACGTAAGG + Intronic
1011911479 6:92445725-92445747 GTTACATTCATATTAATTCAGGG - Intergenic
1012357627 6:98335518-98335540 GCTACTTAGATATTTAAGCAGGG - Intergenic
1023171805 7:37397162-37397184 TTTACTTATATATCAAAGCAAGG + Intronic
1026029750 7:66780308-66780330 GTCACTTACATAGTAAAGAATGG - Intronic
1032248878 7:130235786-130235808 GTTTATTAAATATTAACTCATGG - Intergenic
1032504222 7:132423829-132423851 GTTACTCACATAGCAACACATGG + Intronic
1034727178 7:153347657-153347679 GTTACTTACGTAGTTACTCAAGG - Intergenic
1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG + Intronic
1042508798 8:69590086-69590108 GTTACTTACCTATTTTCGTAAGG - Intronic
1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG + Intronic
1045792799 8:106004680-106004702 GTTTCCTACATATTAACTAATGG + Intergenic
1053401733 9:37830456-37830478 GTTACATACATATGAATTCATGG + Intronic
1185990230 X:4886953-4886975 GTTTCTTATTTATTAAAGCATGG - Intergenic
1188546219 X:31310482-31310504 TGTATTTACATATTAACACAGGG + Intronic
1192611201 X:72569110-72569132 TTTACTTACCTATAAACTCAAGG - Intronic
1192735822 X:73848841-73848863 GTGTTTTACATATTAATGCAAGG + Intergenic