ID: 922407330 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:225328785-225328807 |
Sequence | CTCACTAGGTCGTAAGTAAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 33 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 30} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922407328_922407330 | -1 | Left | 922407328 | 1:225328763-225328785 | CCATGCGTTAATATGTAAGTAAC | 0: 1 1: 0 2: 0 3: 5 4: 67 |
||
Right | 922407330 | 1:225328785-225328807 | CTCACTAGGTCGTAAGTAACAGG | 0: 1 1: 0 2: 0 3: 2 4: 30 |
||||
922407327_922407330 | 0 | Left | 922407327 | 1:225328762-225328784 | CCCATGCGTTAATATGTAAGTAA | No data | ||
Right | 922407330 | 1:225328785-225328807 | CTCACTAGGTCGTAAGTAACAGG | 0: 1 1: 0 2: 0 3: 2 4: 30 |
||||
922407326_922407330 | 1 | Left | 922407326 | 1:225328761-225328783 | CCCCATGCGTTAATATGTAAGTA | 0: 1 1: 0 2: 0 3: 7 4: 84 |
||
Right | 922407330 | 1:225328785-225328807 | CTCACTAGGTCGTAAGTAACAGG | 0: 1 1: 0 2: 0 3: 2 4: 30 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922407330 | Original CRISPR | CTCACTAGGTCGTAAGTAAC AGG | Intronic | ||