ID: 922407330

View in Genome Browser
Species Human (GRCh38)
Location 1:225328785-225328807
Sequence CTCACTAGGTCGTAAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407327_922407330 0 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407328_922407330 -1 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30
922407326_922407330 1 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407330 Original CRISPR CTCACTAGGTCGTAAGTAAC AGG Intronic
909022471 1:70447529-70447551 CTTACTATTTCGTAAGTACCTGG + Intergenic
912325117 1:108750644-108750666 CTAACTAGTTCCTAACTAACTGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG + Intronic
1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG + Intronic
1087539450 11:99496754-99496776 CTCAAGAGGTGGTAAGTAACTGG + Intronic
1093749672 12:22783609-22783631 CTCACTAATTAGTAAGTAATTGG - Intergenic
1102464632 12:113121335-113121357 CTCACTGGGTTGTAAGTTCCTGG - Intronic
1111808243 13:93065174-93065196 CTCACTAGCTCGTAGCTATCTGG - Intergenic
1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG + Exonic
1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG + Intergenic
1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG + Intronic
1151071748 17:71221780-71221802 CCTACTAGGTAGTGAGTAACAGG - Intergenic
1158198585 18:54915257-54915279 CTCACTAGGCAGTAAGTTCCAGG + Intronic
1168324833 19:55533007-55533029 CTCACAAGGCCGTGTGTAACTGG + Intronic
935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG + Intergenic
942852454 2:180505152-180505174 CTCAGTAGGTCTTAAGTGAAGGG + Intergenic
1173186278 20:40842932-40842954 CCCACTAGGTGGTAAGTTCCAGG - Intergenic
952092090 3:29899611-29899633 CACACTAGGTCATAAGAAAGTGG - Intronic
957128726 3:76196869-76196891 CTCACTAGGTATTAAGTAAATGG + Intronic
967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG + Intergenic
968166574 3:196470640-196470662 CTGATTAGGTCGTCAGAAACGGG - Exonic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
981320838 4:143389312-143389334 CTCACTAGGTTTTAATTAAAAGG - Intronic
983877529 4:172893940-172893962 CTGACTAGGTCCTAAGGAAGGGG - Intronic
991466432 5:66917622-66917644 TTAACTAGGACTTAAGTAACTGG - Intronic
992433723 5:76735001-76735023 CTCATTAAGTCTTAAGTAAATGG - Exonic
1013072892 6:106744929-106744951 CTCACTCTGTGGCAAGTAACTGG - Intergenic
1021868007 7:24978413-24978435 CTCATTAGGATGTAAGTACCAGG - Intronic
1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG + Intronic
1031440385 7:121787489-121787511 TTAACTAAGTCCTAAGTAACTGG - Intergenic
1193200587 X:78685686-78685708 CTGGCTAGGTCTTAAGCAACAGG + Intergenic