ID: 922407331

View in Genome Browser
Species Human (GRCh38)
Location 1:225328799-225328821
Sequence AGTAACAGGAGTTTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407326_922407331 15 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data
922407327_922407331 14 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data
922407328_922407331 13 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407331 1:225328799-225328821 AGTAACAGGAGTTTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407331 Original CRISPR AGTAACAGGAGTTTTCTCAA AGG Intronic