ID: 922407332

View in Genome Browser
Species Human (GRCh38)
Location 1:225328810-225328832
Sequence TTTTCTCAAAGGAATCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407327_922407332 25 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407326_922407332 26 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407328_922407332 24 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407332 Original CRISPR TTTTCTCAAAGGAATCAAAA TGG Intronic
900597290 1:3486904-3486926 TTTTCTCAAAGAACTAAAAATGG + Intergenic
900836928 1:5011904-5011926 GTTTCTCCAAGGAAGAAAAATGG - Intergenic
900902748 1:5527932-5527954 TTTTCATAGAGGAATTAAAAGGG - Intergenic
901291412 1:8127086-8127108 TTTTGTTAAAGCAATCTAAACGG + Intergenic
901332270 1:8419697-8419719 AATTCTCAAAATAATCAAAAGGG + Intronic
901876392 1:12169163-12169185 TGTCCTCAAAGGGAACAAAAGGG - Intronic
902568621 1:17332248-17332270 TTGTCTCAAAAAAATAAAAAAGG - Intronic
904243998 1:29173107-29173129 TATTCTCTAATGAGTCAAAAAGG + Intronic
904342816 1:29848567-29848589 TTTCCCCCAAGAAATCAAAATGG - Intergenic
907403607 1:54240595-54240617 TTTCCCCAAATGACTCAAAAAGG - Intronic
908086220 1:60637026-60637048 TTTTGGCAAGTGAATCAAAAAGG + Intergenic
908111348 1:60901653-60901675 ATTTCTCAAAGAACTTAAAACGG - Intronic
908361352 1:63371167-63371189 TTTTCTCAACCATATCAAAAAGG - Intronic
908387306 1:63654549-63654571 ATTTCTCAAATGACTCAACAAGG + Intronic
909077893 1:71075130-71075152 TATCCTAAAAGCAATCAAAATGG + Intronic
909159320 1:72126066-72126088 TTTTCTCTAATGACTCATAAGGG - Intronic
909278609 1:73720740-73720762 CTTTTCCGAAGGAATCAAAAAGG + Intergenic
909328423 1:74382167-74382189 TTGTCTCTTGGGAATCAAAAAGG - Intronic
909545969 1:76846736-76846758 ATTTCTCAAAGGCATGTAAATGG - Intergenic
909877389 1:80825161-80825183 TTTGCTAAATGGAATCAACAAGG + Intergenic
910109300 1:83665501-83665523 TTGTCTCAAAATAATCCAAAAGG + Intergenic
910395915 1:86793736-86793758 TTTTCTGAAAAGAATCTCAATGG - Intergenic
910516168 1:88062489-88062511 TTTACTCAAAGGAAAAAAATAGG + Intergenic
910689564 1:89952004-89952026 ATTAGTCATAGGAATCAAAAAGG - Intergenic
910764830 1:90771231-90771253 TATTCCCAAAGGAATTAATATGG - Intergenic
910834275 1:91492497-91492519 CATACTCAAAAGAATCAAAAGGG + Intergenic
910873861 1:91859156-91859178 TTTTCCCAAAGGCTTCAAATAGG + Intronic
911696830 1:100897840-100897862 GATTCCCAAAGGATTCAAAATGG - Intronic
912075546 1:105870859-105870881 ATTTCTCAAAGAACTTAAAACGG - Intergenic
912346459 1:108967674-108967696 GTTTCTTACAGGAATTAAAAAGG + Intergenic
912737850 1:112165907-112165929 TTTTTTTAAAGGAACCAACATGG + Intergenic
912788458 1:112627196-112627218 TCTACTTAAAGGAATCAAAATGG - Intronic
913295759 1:117318550-117318572 TTTTCTGGAAGGAATGAGAAAGG - Intergenic
913378886 1:118186413-118186435 ATTCCTCAAAGAAATTAAAAGGG - Intergenic
913440355 1:118890286-118890308 TTTCCTCAAATGAAGCAAAGTGG + Intronic
914413299 1:147453418-147453440 TTTCCTCAAAAGAAACAAAATGG - Intergenic
914678019 1:149918516-149918538 TTTGCTCCAATGACTCAAAAAGG + Intergenic
914873972 1:151498788-151498810 TTTTGTGAAAGGAATCCAAATGG + Intergenic
914960813 1:152204889-152204911 GTTTCTAAAAGGAATCAACTAGG + Intergenic
914983425 1:152436415-152436437 ATTTCTCAAAGAACTAAAAATGG - Intergenic
915048082 1:153036038-153036060 ATTTCTCAAAGAACTTAAAATGG - Intergenic
915665786 1:157443264-157443286 TTTTCTTTAAGGAATCAAACTGG - Intergenic
915824085 1:159056940-159056962 TTTTTTCAAAGGAGTCCCAAAGG + Intergenic
916298703 1:163249438-163249460 TTTTCTCAAAGAAATATTAACGG - Intronic
916440293 1:164818377-164818399 TTATCTGAAAGGAATTAGAAAGG - Intronic
916531691 1:165662460-165662482 CTTTCTCAATGGAATGACAAGGG + Exonic
916998045 1:170322733-170322755 ATTTCTCAAAGAACTTAAAATGG - Intergenic
917167751 1:172132230-172132252 TTTCCTCCAAGGAATGACAAAGG - Intronic
917328980 1:173862549-173862571 CTTTCTCAAAGGAAAAAAGAAGG - Intergenic
917697385 1:177540000-177540022 ATTTCTCAAAGAACTTAAAAAGG + Intergenic
917756027 1:178099431-178099453 TTCTCTCAAAAGAAGAAAAAAGG - Intronic
917841783 1:178986004-178986026 ATTTCTCAAAGAACTAAAAATGG + Intergenic
917888573 1:179413791-179413813 ATTTCTCAAAGAACTAAAAATGG - Intronic
917940762 1:179918923-179918945 TTTTCTTCAAGGAAGGAAAAAGG - Exonic
918963659 1:191311892-191311914 TTTTCTCAGAAGGAACAAAACGG - Intergenic
919270207 1:195331784-195331806 TCTTCTAAAAGGAAGAAAAATGG + Intergenic
920082332 1:203383990-203384012 TTATCTCAAAACAAACAAAATGG - Intergenic
920684673 1:208100349-208100371 TTATCTCAAAGAAAAAAAAAAGG + Intronic
920787965 1:209060838-209060860 TTTTTTCAAAGGAAGCATATTGG - Intergenic
920894882 1:210037637-210037659 ATTTCTGAAATGAATGAAAATGG - Intronic
921652791 1:217698508-217698530 TTTTTTAAAAGGAAAGAAAATGG - Intronic
921864523 1:220074227-220074249 TTTTCTCAAAGGATTAATAGTGG + Intronic
921928036 1:220729292-220729314 TTGTCTCTCAGTAATCAAAATGG - Intergenic
922034124 1:221831839-221831861 TTTACTCTAAGGGATCATAATGG + Intergenic
922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG + Intronic
922409053 1:225351761-225351783 TTTTATCAAACGTATCACAATGG + Intronic
922883374 1:228999439-228999461 CTTTCACAATGGAATCAAGAAGG + Intergenic
923463326 1:234226390-234226412 TTTTCAGAAAGGACTCAACAAGG + Intronic
923840256 1:237663363-237663385 TTTTATAAAAGGAATACAAATGG + Intronic
923886444 1:238163158-238163180 TTTATTCAAAGGAATAATAAGGG - Intergenic
924045738 1:240028076-240028098 ATTTTTTAAAGGAATCAAGAAGG + Intronic
924391397 1:243563421-243563443 TTTTAATAAATGAATCAAAATGG + Intronic
924525881 1:244847956-244847978 TTTTCTCAAATGAACAGAAATGG + Intronic
924544625 1:245015120-245015142 TTGTCTCAAAGAAAAGAAAAAGG - Intronic
924695973 1:246400058-246400080 TTTTCCCAAAAGAAAAAAAAAGG + Intronic
924764766 1:247021978-247022000 TTTTAATAAAGGAAACAAAATGG + Intergenic
1063051120 10:2448990-2449012 TTTTCTCACAGAAATCTTAAAGG - Intergenic
1063406659 10:5802231-5802253 TTTTCTCAAAGAAAACCTAAAGG + Intronic
1064800007 10:19059860-19059882 TTTTCCCAAACCAATGAAAAAGG + Intronic
1066104703 10:32146279-32146301 TTTTCACAGAGGACTCAAAAGGG - Intergenic
1067016512 10:42759651-42759673 TGTTCTCAAATGAATGAAGATGG + Intergenic
1067556186 10:47274513-47274535 ATTTCTCAAAGTACTTAAAACGG + Intergenic
1067680144 10:48429649-48429671 TTTTCTTCAAAGAAACAAAAAGG - Intronic
1067983769 10:51117757-51117779 TTTTATTTAAGGAATCAATAAGG - Intronic
1068553306 10:58429978-58430000 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1068953208 10:62798747-62798769 TCTTCTCAGAGGAAAAAAAAAGG + Intergenic
1069044701 10:63730594-63730616 ATTTCCCAAAGAAATAAAAATGG + Intergenic
1069400828 10:68044270-68044292 TCTTATCAAAGGACTCAAAGGGG + Intronic
1069435459 10:68378003-68378025 TTTTCTCTAAGGTTACAAAAAGG + Intronic
1070158577 10:73851601-73851623 ATTTGTCAAAGGAAAGAAAAGGG + Intronic
1070817268 10:79332547-79332569 TTGTCTCAAGGGAACAAAAAAGG + Intergenic
1070818191 10:79338514-79338536 TTGTCTCAAGGGAACAAAAAAGG - Intergenic
1071010438 10:80933993-80934015 TTTCTTCAAAGAAATAAAAATGG + Intergenic
1071168566 10:82835443-82835465 TATTATCAAAGGAAACAGAATGG + Intronic
1071169269 10:82844763-82844785 TTTCCTCAAAGGAACAACAAAGG + Intronic
1071221294 10:83468124-83468146 TTTTCTCAAAGACATACAAATGG + Intergenic
1071581978 10:86780096-86780118 ATTTCTCAAAAGAAGAAAAATGG - Intronic
1071974608 10:90942422-90942444 TTTTCTGAATTGAATTAAAAAGG + Intergenic
1072062143 10:91823637-91823659 TCATCTAAAAGGGATCAAAATGG - Intronic
1072388030 10:94952274-94952296 TTTTCTCAAAGGAGCCAATGGGG + Intronic
1073006300 10:100327721-100327743 TTTGCTGAAAGGAATTGAAAGGG + Intronic
1073576252 10:104627992-104628014 TTATTTCAAAAGAATTAAAATGG + Intergenic
1073655122 10:105406071-105406093 ATTTCACAAAGGACTAAAAATGG - Intergenic
1073699504 10:105909984-105910006 TCTTCTCAAAGGAAAACAAAGGG + Intergenic
1073881392 10:107984838-107984860 TTTTCTCAGAGGAAAGAAAAGGG + Intergenic
1074152862 10:110773574-110773596 TATTTTCAAAGAAATAAAAATGG + Intronic
1074255698 10:111800218-111800240 ATTCCTCAAAGGAGGCAAAAGGG + Intergenic
1074646381 10:115457641-115457663 TTTTCTCAATAAAATCAGAAAGG - Intronic
1074837114 10:117306512-117306534 ATTTAACAAAGGAATTAAAAAGG - Intronic
1074988888 10:118684258-118684280 TTTTCTGAAAGGAATAAAATTGG - Exonic
1075162766 10:120039470-120039492 TTCTCTCATAGGAACCATAATGG - Intergenic
1076172143 10:128328269-128328291 TTATCTCCAAGGAATAAAAAGGG + Intergenic
1077429780 11:2510599-2510621 CTTTCTCAAAGGAACAAACAAGG + Intronic
1078039165 11:7841970-7841992 TTATCTCAAACTAGTCAAAATGG - Intergenic
1078630110 11:12994844-12994866 TTTTTTCTAATGAATCACAAGGG + Intergenic
1078751015 11:14163804-14163826 CTTTCTCTCAGGAATCAATATGG - Intronic
1078806022 11:14705093-14705115 TATTTTCCAAGGAATGAAAATGG - Intronic
1079507699 11:21172501-21172523 TTTTCTCAAAGTCAGCAAAGGGG - Intronic
1079803076 11:24895886-24895908 ATTTCTCAAAGAACTTAAAAGGG - Intronic
1080471466 11:32550155-32550177 TTTTCACTAAGGAATCCAAAAGG + Intergenic
1080650608 11:34219968-34219990 TTTACTCAAAGAACTCCAAAGGG + Intronic
1080789142 11:35505053-35505075 TTTCTTCAAACAAATCAAAATGG - Intronic
1081088364 11:38829508-38829530 ATTTCTCAAAGAAATAAAAATGG + Intergenic
1081629564 11:44680069-44680091 TAATCACAAAGGAACCAAAAAGG - Intergenic
1081912516 11:46708943-46708965 TTTTCTCAAAAAAAAAAAAAAGG + Intergenic
1082206638 11:49443387-49443409 TTTCCTCAAAGGAAAAATAAAGG - Intergenic
1082713205 11:56580087-56580109 TTAGCACAAATGAATCAAAATGG + Intergenic
1082929115 11:58580129-58580151 ATTTCTCAAAAGAATGAGAAGGG - Intronic
1082988105 11:59185125-59185147 TTTTCTAAAGGGAAGCAAGAAGG + Intronic
1083517556 11:63274475-63274497 TTTTGAGAAGGGAATCAAAATGG + Intronic
1083559182 11:63658651-63658673 TTTTATCAAAGAATTTAAAATGG - Intronic
1084223443 11:67699374-67699396 TTTTCTTAAGGGTTTCAAAAGGG - Intergenic
1085335831 11:75694100-75694122 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1085572966 11:77575431-77575453 TTTTATAAAAGGCATCAAAGGGG + Intronic
1085885772 11:80519945-80519967 TTTTCTCACAGGAGAGAAAAAGG + Intergenic
1085986131 11:81790881-81790903 TTTACTCAAAGGATGGAAAAGGG - Intergenic
1086648630 11:89258377-89258399 TTTCCTCAAAGGAAAAATAAAGG + Intronic
1086672944 11:89569638-89569660 ATTTCTCAAAGAACTTAAAATGG + Intergenic
1087299681 11:96417392-96417414 TTTCTTCAAAGAAATGAAAATGG + Intronic
1087827832 11:102786489-102786511 TTCTCTAAAAGGATTCAAACTGG + Intergenic
1087873151 11:103324700-103324722 TATACTCAAAGGAATATAAATGG - Intronic
1088081746 11:105925081-105925103 TTTTTTAAAAGGAAACAAAATGG - Intronic
1088496660 11:110438177-110438199 ATTTCTCAAAGAACTAAAAATGG - Intronic
1090253501 11:125266992-125267014 CTGTCTCAGAGAAATCAAAAGGG - Intronic
1090634231 11:128679922-128679944 TTTTCTCAAAGGTGTCCCAAAGG + Intergenic
1090963947 11:131581905-131581927 TCTTCTCAAGGGAAACAAACTGG + Intronic
1092573761 12:9755866-9755888 TTATCTCAAAGGACACAGAATGG - Intronic
1093292147 12:17340231-17340253 TTATCTCAAATATATCAAAAAGG - Intergenic
1093494082 12:19735496-19735518 ATTTCCCAAAGGAATTACAACGG - Intergenic
1093601917 12:21037353-21037375 TTTCCTGAAATGAATGAAAATGG - Intronic
1093613537 12:21192941-21192963 AATTGTCAAAGAAATCAAAAGGG - Intronic
1093861530 12:24172833-24172855 TTTTCTCAAGAGAATGAGAAAGG + Intergenic
1094237114 12:28181483-28181505 ATTTCTCAAAGAACTAAAAATGG + Intronic
1094626382 12:32128253-32128275 TTTTCATAAAGTATTCAAAAAGG + Intronic
1095304439 12:40622962-40622984 TTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1095623684 12:44288329-44288351 TTCTCCAAAAGGAATAAAAATGG - Intronic
1095770912 12:45955722-45955744 TTGTATATAAGGAATCAAAATGG - Intronic
1096036925 12:48480650-48480672 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1096131779 12:49164964-49164986 TTTTCTTAAAAGCATTAAAAAGG - Intergenic
1097242088 12:57582495-57582517 TTTTCTCTAAGGGATTAAGATGG + Intronic
1097475174 12:60045862-60045884 ATTTCTCAAAAGAATATAAATGG - Intergenic
1098501601 12:71199012-71199034 TTTGCTCACAGCAATTAAAAGGG + Intronic
1098955477 12:76685230-76685252 TTTTCAAAAAGCAGTCAAAAAGG - Intergenic
1099666486 12:85636521-85636543 TTTTCTCAAAAGAAATAAACAGG + Intergenic
1099767977 12:87014151-87014173 TTTACTCAAAGTAATAAACATGG + Intergenic
1099934265 12:89106980-89107002 ATTTTTCAAAGGAAACAAGATGG + Intergenic
1100030130 12:90177049-90177071 TTATCTCAAAGAAAAGAAAATGG - Intergenic
1100429864 12:94521802-94521824 TTTTCTCATGGTAATCCAAATGG + Intergenic
1100878428 12:98989383-98989405 TTTTCACAAAGGTACCAAGAAGG - Intronic
1101171520 12:102101729-102101751 CTGTCTCAAAGGAAAAAAAAAGG - Intronic
1101326772 12:103722717-103722739 TTCTCTTAAAGGAAAAAAAAAGG + Intronic
1102496727 12:113324706-113324728 CTGTCTCAAAGGAAAAAAAAGGG - Intronic
1103131842 12:118475781-118475803 TTATTTTAAAGGAATAAAAAAGG - Intergenic
1103471738 12:121187238-121187260 GTTTTTAAAAGGTATCAAAATGG - Exonic
1103741142 12:123092378-123092400 TTTTTTCAAAACAAACAAAAAGG + Intronic
1104096902 12:125566233-125566255 TTTGTTCAGAGGAAACAAAAGGG - Intronic
1104879889 12:132063494-132063516 GTGTCTCAAAGGAAAAAAAAAGG + Intronic
1104947172 12:132421054-132421076 TTTTCTCACAGTCATCACAAAGG - Intergenic
1105552991 13:21415601-21415623 TTCTCTCAAAGTATTCAAGAGGG - Intronic
1106323757 13:28667635-28667657 TCTTCTAATAGTAATCAAAAAGG - Intronic
1106497898 13:30297459-30297481 ATTTCTCAAAGAACTTAAAACGG + Intronic
1107043205 13:35970378-35970400 TTTTGCCAAAAGAATAAAAATGG + Intronic
1107066116 13:36215441-36215463 TTTTCTCAACGGAAACAATGAGG + Intronic
1107146435 13:37065699-37065721 TTTTCTCACAGGTTGCAAAATGG - Intergenic
1107511479 13:41090257-41090279 TTCTCTCAAAGAAAAAAAAAAGG - Intergenic
1108716286 13:53081324-53081346 TTTTCCCAAAGTAAGCAAATCGG - Intergenic
1108767384 13:53649109-53649131 TTTTCTTAAAGAAATTAAGAAGG - Intergenic
1109010108 13:56929545-56929567 TTTTCTCAAAGAAAGCACACAGG - Intergenic
1109132380 13:58603580-58603602 TTTTCTCAAAGGGTTTTAAATGG - Intergenic
1109134948 13:58636089-58636111 TACACTCAAAGGAATAAAAAAGG - Intergenic
1109387656 13:61653592-61653614 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1109733325 13:66446634-66446656 ATTGCCCAAGGGAATCAAAATGG - Intronic
1109811857 13:67523487-67523509 TTTTCCAAAGGGAATGAAAATGG - Intergenic
1109834472 13:67839451-67839473 GTGTCAAAAAGGAATCAAAATGG - Intergenic
1109847569 13:68016092-68016114 TTGTCTCAAAAAAATAAAAAAGG - Intergenic
1110339393 13:74371376-74371398 GTTTCTGAAAGGAAGCAAAAAGG - Intergenic
1110399766 13:75076380-75076402 GTTTGTGAAAGGAATGAAAATGG - Intergenic
1110660693 13:78056745-78056767 TTTTCTTAAGGGTTTCAAAAGGG + Intergenic
1110674813 13:78229258-78229280 ATTTCTCAAAGAACTAAAAACGG + Intergenic
1111053976 13:82923690-82923712 TTCTCTCACAGAAAGCAAAAGGG + Intergenic
1111282782 13:86049323-86049345 TTTTCTCAAAGATATAAACAAGG + Intergenic
1111720714 13:91940541-91940563 TTTTCTCAAAGAACTAAAAATGG - Intronic
1112253173 13:97802568-97802590 TTGTCTCAAAGGGACTAAAAAGG + Intergenic
1112330738 13:98475215-98475237 GTATTTCAAAGGAATGAAAACGG + Intronic
1112638306 13:101242733-101242755 TTTTCTCAAATAAATACAAAGGG + Intronic
1112801416 13:103113888-103113910 TTTTTCCACATGAATCAAAATGG - Intergenic
1113130139 13:107027347-107027369 ATTTCCCAAATGAATCAAATAGG - Intergenic
1113145507 13:107203560-107203582 TTCCCTCAATGGCATCAAAAAGG + Intronic
1113301783 13:109029990-109030012 TTTTCATAAAGGAATCAATGAGG + Intronic
1113421637 13:110175650-110175672 CTTTCTCAACAGAATAAAAATGG + Intronic
1113552413 13:111203298-111203320 TTTTTTAAAAGGAATTAAATAGG - Intronic
1113583257 13:111444174-111444196 GTTTCTCAAAAGATTAAAAAAGG - Intergenic
1114132651 14:19810432-19810454 ATTTCTCAAAGAACTTAAAAGGG + Intronic
1114473166 14:22977706-22977728 GTTTAGCAAAGGAATCAGAATGG + Intronic
1114574290 14:23698372-23698394 TTTTATAAAAGGCATCAAAGGGG + Intergenic
1114657543 14:24325100-24325122 GTTTCTCAATGGAAACAAACTGG + Intronic
1114967976 14:27987681-27987703 TTTACTCCAAGTAAACAAAAGGG - Intergenic
1114990535 14:28281626-28281648 TTTTCTCAATGGAGTTTAAATGG + Intergenic
1115063171 14:29219917-29219939 TTTTCCCAAAAGTGTCAAAATGG - Intergenic
1115175265 14:30554868-30554890 TTTTCAAAAAGCAATAAAAATGG - Intergenic
1115371151 14:32616196-32616218 ATTTCTCAAAGAGATAAAAATGG + Intronic
1115372979 14:32639731-32639753 TGTTCACCAAGGAAGCAAAATGG + Intronic
1115840509 14:37464199-37464221 ATTTCTCAAAGAAATAAAAATGG + Intronic
1115886828 14:37981575-37981597 TTTTATTAAAGGTTTCAAAAGGG - Intronic
1116258166 14:42585017-42585039 TTTTTTCAAAGGAACCAATGAGG - Intergenic
1116307477 14:43276627-43276649 TTTTATCTAAGGAATAAGAAAGG + Intergenic
1116557423 14:46329300-46329322 TTTACTAAAAGCAATAAAAATGG + Intergenic
1116785598 14:49284942-49284964 TTTTCTCAAACAATCCAAAATGG - Intergenic
1116802001 14:49453110-49453132 GTCTCTCAAAGGATTGAAAATGG + Intergenic
1116977392 14:51131399-51131421 CCTTCTCAAAGGCATTAAAAGGG + Intergenic
1117243824 14:53863390-53863412 TATTTTCAAAGCAATAAAAAAGG + Intergenic
1117447990 14:55823038-55823060 TTTTCACAGAGCAAGCAAAAAGG + Intergenic
1117855493 14:60027140-60027162 CTTTCTCAAAGACATAAAAATGG - Intronic
1118080543 14:62354117-62354139 TTATCCCATAGGAATGAAAAGGG - Intergenic
1118136380 14:63032811-63032833 TTTCTTCAAGGGAATGAAAAGGG + Intronic
1118674629 14:68170696-68170718 TTTTGTCAAAGGAATTTTAATGG + Intronic
1118999667 14:70870930-70870952 TTTTTTCAAAGGAGTCCCAAGGG + Intergenic
1119752832 14:77092524-77092546 TTTTGTGAAAGTAATGAAAAGGG - Intergenic
1119955348 14:78792521-78792543 ATTACTCAAAGGTATCAAACTGG + Intronic
1122763918 14:104051500-104051522 ATTTCTCAAAGGTCTTAAAACGG - Intronic
1123571322 15:21612869-21612891 TATTCCCAAAAAAATCAAAAAGG - Intergenic
1123607436 15:22048221-22048243 TATTCCCAAAAAAATCAAAAAGG - Intergenic
1123973431 15:25530186-25530208 TTTTCTCAAAGAACTAAAAATGG - Intergenic
1124016106 15:25877161-25877183 TTTGCTCTTGGGAATCAAAAAGG - Intergenic
1124938459 15:34195039-34195061 ATTTCTCAAAGAACTAAAAACGG + Intronic
1125073915 15:35590586-35590608 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1125625198 15:41102662-41102684 CTGTCTCAAAGGAAAAAAAAAGG + Intronic
1126014036 15:44332686-44332708 ATTTCTCAAATGTATAAAAAAGG - Intronic
1126133147 15:45363507-45363529 ATATTTCAAAGGACTCAAAAGGG - Intronic
1127220710 15:56877619-56877641 TTTTCTCAAAAAAAAAAAAAAGG - Intronic
1127766440 15:62189873-62189895 TTTTCACAAAGGACTCAGCAGGG + Intergenic
1127775101 15:62258273-62258295 GTTTCTCAAAGAACTCAATAAGG + Intergenic
1128503401 15:68246507-68246529 ATTTTTCAAACGAATCAAAATGG + Intronic
1129106570 15:73312888-73312910 TTTTGACAAGGGAATTAAAATGG - Intergenic
1129887881 15:79051375-79051397 TGTTCTCAAAGGATCGAAAAGGG - Intronic
1129913711 15:79249368-79249390 TTGTCTCAAAAAAATAAAAAAGG - Intergenic
1131391359 15:92051471-92051493 TTTGCTCAATGGAACCAAATAGG + Intronic
1131861929 15:96662920-96662942 TGTTCTGAAAGGAAGAAAAAGGG - Intergenic
1132126466 15:99230823-99230845 TGTTCTCAAAGAAATGTAAAAGG + Intronic
1132360086 15:101205154-101205176 TTTTTTTAAAGTAATCAACATGG + Intronic
1132375361 15:101325107-101325129 TTTCCTCAGAGGAAACAAAGGGG - Intronic
1202979675 15_KI270727v1_random:339995-340017 TATTCCCAAAAAAATCAAAAAGG - Intergenic
1133290219 16:4715589-4715611 TTGTCTCAAAAAAATAAAAAAGG + Intronic
1133659163 16:7898592-7898614 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1134473209 16:14547122-14547144 TTTTCTCAAAGTAGTCAAGCAGG - Intronic
1134535348 16:15021988-15022010 TTTTCTTTAAGAAAACAAAAAGG + Intronic
1134558402 16:15186288-15186310 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1134918933 16:18097889-18097911 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1135337609 16:21616589-21616611 TTTTTTCAAAGGCATCACTATGG + Intronic
1135633653 16:24055928-24055950 TTTTGTCAATGGAGACAAAATGG - Intronic
1135719061 16:24799252-24799274 TTTTCACAGAGCAATCCAAAAGG + Intronic
1135763352 16:25155542-25155564 TTCTCTCAAAAGAGTGAAAAAGG + Intronic
1135912838 16:26577133-26577155 TTGTTTCAAAGGAAGCAAAAAGG - Intergenic
1136690776 16:32026989-32027011 ATTTCTCAAAGAACTTAAAACGG - Intergenic
1136747094 16:32600384-32600406 TTGTCTCAGAGGATTCACAATGG + Intergenic
1136878451 16:33883374-33883396 ATTTCTCAAAGAACTTAAAACGG + Intergenic
1137022885 16:35447739-35447761 GTTTCTCAAAAGAATCCAAGTGG + Intergenic
1137454924 16:48610636-48610658 TTTACTGAAAGAAATAAAAAGGG - Intronic
1137752403 16:50876532-50876554 TTTGCCCAAAGGAATTAACAGGG - Intergenic
1138347535 16:56329193-56329215 TTTTCTAAAATAAAACAAAATGG - Intronic
1138736935 16:59261628-59261650 TTTTATAAAAGGAAAAAAAAAGG - Intergenic
1138794938 16:59956446-59956468 CTTTCTCAACAGAATCAAGAGGG - Intergenic
1138843872 16:60541051-60541073 TTTTTTCAAAGGACACACAATGG + Intergenic
1138859736 16:60742338-60742360 TTTTCTCAAAGAAAAAAAACAGG - Intergenic
1140154732 16:72412123-72412145 TTTCTCCAAAGAAATCAAAATGG + Intergenic
1140245082 16:73241030-73241052 TTTTCTCAAAGAAAGAAAACTGG + Intergenic
1140298415 16:73731039-73731061 TTTTCTTAAAGGATAAAAAAAGG + Intergenic
1140343316 16:74187285-74187307 TTGGCTTAAAGGAATCCAAAAGG - Intergenic
1140587123 16:76306205-76306227 ATTTCTCAAAGAACTTAAAACGG - Intronic
1140809680 16:78565538-78565560 TATTCCCAATGAAATCAAAAGGG - Intronic
1141306582 16:82870171-82870193 GTTTCTCAAAGGAAGACAAATGG + Intronic
1141545748 16:84767196-84767218 GTTTCTCAACGGAATAAAATGGG - Intronic
1203049224 16_KI270728v1_random:859591-859613 TTGTCTCAGAGGATTCACAATGG + Intergenic
1203093572 16_KI270728v1_random:1232020-1232042 ATTTCTCAAAGAACTTAAAACGG - Intergenic
1142574841 17:899901-899923 TTTTCACAAAGGAAATCAAAGGG + Intronic
1142803185 17:2357821-2357843 TTTGGGCAAATGAATCAAAATGG - Intronic
1142848977 17:2695277-2695299 TTTTCTGGAAGGATTCAGAAGGG + Exonic
1143181271 17:4985980-4986002 TTTTCTAAAGGGAATTAGAAGGG + Exonic
1143443082 17:6990901-6990923 TTTTCTTAATGGCATCTAAATGG - Intronic
1143574037 17:7779359-7779381 TTATTTCAAAGCCATCAAAATGG - Exonic
1144261943 17:13530115-13530137 TCTATTCAAAGGAATGAAAAGGG - Intronic
1144868515 17:18353076-18353098 TTGTCCCAAAGGAAACAGAAAGG - Intronic
1145113862 17:20189918-20189940 TTTTAACAAAGGAAGTAAAATGG + Intronic
1146006148 17:29161960-29161982 CTTTCCCTAAGGAATCAAAGGGG + Intronic
1146010172 17:29187782-29187804 CTGTCTCAAAATAATCAAAAAGG + Intergenic
1149025396 17:52021357-52021379 ATTTCTCAAAGGACTAAAGATGG - Intronic
1149254909 17:54815112-54815134 TTTTCTAAAATGAATGCAAAAGG + Intergenic
1149709993 17:58732347-58732369 TTTTCTCTAAGAACACAAAAAGG - Intronic
1150513522 17:65782433-65782455 ATTTCTCAAAGAACTAAAAATGG + Intronic
1152396156 17:80035246-80035268 TTTTCCCAAAGGAAAGAACAAGG + Intronic
1153875952 18:9370942-9370964 TTTTCTCTAAGTAGCCAAAATGG + Intronic
1154006177 18:10529004-10529026 TTTTCTCCAAAGAATCAATAAGG - Intronic
1155602263 18:27563126-27563148 TATTCTCAAGTGAAACAAAAAGG + Intergenic
1155779243 18:29810469-29810491 TTTTGTTAAAGCAATCCAAATGG + Intergenic
1156621854 18:38862060-38862082 TTTTTTCAAAGGATCAAAAAAGG - Intergenic
1156739920 18:40312274-40312296 TTTTCTGAAAGGAAAGATAATGG + Intergenic
1156769061 18:40697664-40697686 TTTCCTCATAGGTATGAAAATGG + Intergenic
1156931783 18:42653672-42653694 ATTTCTCAAAGAACTCAAAGCGG + Intergenic
1156972202 18:43170287-43170309 TTTCTTCAAAGGAATCCTAAGGG - Intergenic
1158807675 18:60994478-60994500 TCTTCTCAATTGAATAAAAATGG - Intergenic
1158938551 18:62385967-62385989 TTTTCTAAAAGAAAGAAAAAAGG + Exonic
1158955165 18:62531066-62531088 TTTTTTAAAGGGAAGCAAAAAGG + Intronic
1159118932 18:64147189-64147211 TTTTCTGAAGGGAATGAATAAGG - Intergenic
1159322847 18:66876060-66876082 TTATCCAAAAGGAATAAAAATGG - Intergenic
1159397711 18:67885338-67885360 TTATCTCACACGAATCAGAATGG - Intergenic
1159415781 18:68147036-68147058 TTTCCCCAAAGAAATGAAAAAGG + Intergenic
1159418968 18:68190667-68190689 ATTTCTCAAAGAACTGAAAACGG - Intergenic
1159441695 18:68488201-68488223 TTTTCTGAAAGCTATCACAAAGG - Intergenic
1159504508 18:69317507-69317529 TTATCTTAAAGGATTCTAAAGGG - Intergenic
1159515837 18:69456697-69456719 ATTTCTCAAAGAACTTAAAATGG - Intronic
1159714622 18:71806136-71806158 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1159769823 18:72536787-72536809 TAATCCCAAAGCAATCAAAAAGG - Exonic
1160000716 18:75019093-75019115 TTATCTCAAAGGATGCCAAAAGG + Intronic
1163219883 19:15911343-15911365 TTTTCTCAGATGAGGCAAAAAGG + Intergenic
1165298651 19:34951679-34951701 TTATATCAAAGAAATCACAAAGG + Intergenic
1166593298 19:44021266-44021288 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1166639171 19:44480109-44480131 TTGTCTCAAAAGAAAAAAAAAGG - Intronic
1166889574 19:45982260-45982282 TTATCTAAAAGAAATAAAAATGG + Intergenic
1166923402 19:46248417-46248439 TTTTCAAAAAGGAATACAAATGG + Intergenic
925486128 2:4333503-4333525 TTATCTAAAATGAATCACAAGGG - Intergenic
927353484 2:22146206-22146228 ATTTCTCAAAGAACTAAAAATGG - Intergenic
927926468 2:27017129-27017151 TTTGCTCAAAGGAAACAAGGAGG + Intronic
928717637 2:34080567-34080589 GTATCTCAAAGGAATGAATAAGG - Intergenic
929394350 2:41505344-41505366 CTTTCTCCAAGGTATCATAAAGG + Intergenic
931195032 2:60043874-60043896 AGTTCTCAAAGAAAACAAAAAGG - Intergenic
931413148 2:62054288-62054310 TTATCTCAAAGAACTAAAAATGG + Intronic
931500769 2:62863653-62863675 TTTTCTCAAAGTTTTCAAAGAGG - Intronic
931627151 2:64267138-64267160 TTTTTTCAAAGCATTAAAAAGGG + Intergenic
932088872 2:68787172-68787194 TGTTCTCAAATGGACCAAAAAGG - Intronic
932528353 2:72498186-72498208 ATTTATCGAAGGAAACAAAAAGG + Intronic
933459724 2:82566830-82566852 TCTAGTCAAAGGAATCTAAATGG - Intergenic
933475730 2:82788193-82788215 ATTTCTCAAAGAACTAAAAATGG + Intergenic
933588179 2:84202291-84202313 TGTTCTCAAAGGAGGCAAAAGGG + Intergenic
933851541 2:86370818-86370840 TTTTCACAGAGCAAGCAAAAAGG + Intergenic
935311430 2:101787726-101787748 TTTGTGCAAAGGAACCAAAATGG - Intronic
935617663 2:105102684-105102706 TTCTCTCAAAGGAGAAAAAAAGG - Intergenic
935753103 2:106256301-106256323 TTTACTCACAGCATTCAAAAGGG + Intergenic
936119890 2:109732183-109732205 TTTACTCACAGCATTCAAAAGGG - Intergenic
936365322 2:111849035-111849057 TTGAATTAAAGGAATCAAAAAGG - Intronic
936944170 2:117915538-117915560 TTTTCTTAATAGAACCAAAATGG - Exonic
937428916 2:121821992-121822014 TTTTCTCAAAAAAAAAAAAAAGG - Intergenic
937453475 2:122021925-122021947 TTTGTTCAAAGGAATGCAAAGGG - Intergenic
937559479 2:123204715-123204737 TTTTCTGAAACAAATGAAAATGG - Intergenic
937952046 2:127395981-127396003 ATTTCTCAAAAGACTCAAAATGG + Intergenic
938194047 2:129310378-129310400 TGTGCTCAAAGGAGACAAAAAGG + Intergenic
938773400 2:134520341-134520363 TTTTCTCATAGCAAGCAAGAAGG - Intronic
938985654 2:136572840-136572862 TTATCTCTAAGAGATCAAAAAGG - Intergenic
938999933 2:136722552-136722574 TTTTCTCAAAGAACTTAAAGCGG - Intergenic
939207963 2:139132415-139132437 ATTTCTCAAAGAACTTAAAATGG - Intergenic
939303409 2:140377481-140377503 TTTTCTCAATCAAATCTAAAAGG - Intronic
939680162 2:145120864-145120886 TTTATTCAAAGGCATCTAAATGG - Intergenic
940228193 2:151422482-151422504 TTTTCCCAAAAGACTCCAAAAGG - Intronic
940557144 2:155243605-155243627 TTTTCTTGAAGGAATAAAACAGG - Intergenic
940717189 2:157239344-157239366 TTTCCTCAAAGTAACCAATATGG - Intergenic
941298733 2:163774087-163774109 CTATCACAAAGGAATCAAATTGG + Intergenic
941314195 2:163972087-163972109 TTTTCTCAAATTTATCAATATGG + Intergenic
942216343 2:173723013-173723035 TTTTCTGGAAGGAGGCAAAAAGG + Intergenic
942925841 2:181430922-181430944 TTTTCTGAAAGGATTGACAAGGG + Intergenic
943682158 2:190779853-190779875 TTTTCTGAAATGAATCTTAAAGG + Intergenic
943904612 2:193482300-193482322 TTTTCTCACAAAAATTAAAATGG + Intergenic
943995344 2:194757355-194757377 TTTTGACAAATGAATGAAAAGGG - Intergenic
944556608 2:200893574-200893596 TTTTTTCAAAACAATAAAAACGG + Intronic
944654562 2:201864712-201864734 TTTATTCAAAGGAAACAGAAGGG + Intronic
944797683 2:203204669-203204691 TTTTATCAAAGGACATAAAAAGG - Intronic
945112058 2:206369292-206369314 GCTTCTTAAAGGAATCAAATTGG + Intergenic
945397422 2:209337097-209337119 TTTTCTCCAAGGCATCAAAATGG - Intergenic
945600800 2:211862659-211862681 TTTGCTCAAAGAATTTAAAATGG + Intronic
945698504 2:213140394-213140416 TTATCTCAAAGTCTTCAAAAAGG + Intronic
946017087 2:216612612-216612634 CTTTTTCCAAAGAATCAAAAGGG - Intergenic
946154966 2:217801297-217801319 TTTTCCCAAAGGGAGCAAGAGGG - Exonic
946203611 2:218087372-218087394 TTTTCTCACAGCATCCAAAATGG - Intronic
946704220 2:222441923-222441945 CTTTCTTAAACGAAACAAAATGG + Intronic
946746546 2:222852258-222852280 ATTTCTCAAAGAACTAAAAATGG + Intergenic
947499072 2:230659149-230659171 TTTTCTCCAAGCACTCAAGATGG + Intergenic
947631574 2:231656868-231656890 ATTTCTCAAAGAAAAAAAAATGG + Intergenic
947862723 2:233373412-233373434 TTATACCAAAGGAAACAAAAAGG + Intronic
1168977232 20:1976106-1976128 TTTGATCAAAGGACTCAATAAGG - Intergenic
1169051108 20:2578591-2578613 TTTTCTGAAAAGAGTCAGAAAGG - Intronic
1169808705 20:9586273-9586295 TTATCTCAAAGGAATCACACAGG - Intronic
1170168757 20:13387710-13387732 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1170388571 20:15848042-15848064 TCTTCTCAAGGGAATGGAAAGGG - Intronic
1170404782 20:16024741-16024763 TTTGCTCAAAGGAAGCCACAGGG + Intronic
1170696155 20:18661027-18661049 TTTTGACAAAGGTATAAAAATGG - Intronic
1170981813 20:21221326-21221348 ATTTGTCAAATGAATAAAAATGG + Intronic
1171152521 20:22839736-22839758 TTTAATTAAAGGAATTAAAATGG + Intergenic
1173131840 20:40401172-40401194 ATTTCTCAAAGAACTTAAAACGG - Intergenic
1173312166 20:41906305-41906327 TTATCTCAAAGAAATAGAAAAGG + Intergenic
1174093856 20:48071608-48071630 TTTGCTAAAAGAAATAAAAAAGG + Intergenic
1174257897 20:49271946-49271968 TTTTTACAAAGGACGCAAAAGGG + Intronic
1174715398 20:52752330-52752352 TTTTATCAAAAGAAGAAAAAAGG + Intergenic
1175007130 20:55696575-55696597 TATTTTCAAAGGAATCCACAAGG - Intergenic
1175212768 20:57371706-57371728 TTGATTCAAAAGAATCAAAATGG + Intronic
1175326395 20:58131497-58131519 TTTTTGCAAAGGAATCAAGGGGG - Intergenic
1175326975 20:58136651-58136673 TTTGCTTAAATGATTCAAAATGG - Intergenic
1176923341 21:14716296-14716318 TTTTCTCATAGTCATCATAAAGG + Intergenic
1176994191 21:15535164-15535186 TTCTCACACAGGAATCAAAGTGG - Intergenic
1177040456 21:16103776-16103798 TCTTCTTAAATGTATCAAAATGG + Intergenic
1177078694 21:16611529-16611551 TTTCGTAAGAGGAATCAAAAAGG - Intergenic
1177338623 21:19767238-19767260 ATTTCTCAAAGAACTTAAAAGGG - Intergenic
1177578155 21:22984686-22984708 TGTATTCAAAGGAATAAAAATGG + Intergenic
1177705166 21:24694876-24694898 TTTTCTCAAATGAAAATAAAAGG + Intergenic
1178294465 21:31397428-31397450 TTTTTTCAAAGGAATTAAAATGG - Intronic
1178600541 21:33990742-33990764 CTGTCTCAAAAAAATCAAAAAGG + Intergenic
1178673639 21:34613727-34613749 CTTTCTGAAAGGAATTACAATGG - Intronic
1178881236 21:36451804-36451826 TTTTTTAAAAGTAAACAAAAGGG - Intergenic
1181914120 22:26265655-26265677 TTTTCTTTAAGAAATAAAAATGG + Intronic
1183269487 22:36851723-36851745 TTTTCCTAAAGGCATCAAAAGGG - Intergenic
1184620677 22:45673919-45673941 TTTTCTCCAAGTTATAAAAAGGG - Intronic
1184991300 22:48171709-48171731 TTGCCTCACAGGAAGCAAAAGGG - Intergenic
949367229 3:3295937-3295959 ATTTCTCAAAGAACTTAAAACGG + Intergenic
949617082 3:5765750-5765772 ATTTCTCAAAGAACTTAAAATGG - Intergenic
950299479 3:11863645-11863667 ACTGCTCAAAGAAATCAAAAAGG - Intergenic
951047306 3:18054542-18054564 ATTTCTCAAAGAACTTAAAACGG - Intronic
951732493 3:25825802-25825824 ATTTCTCAAAGGACTTAAAATGG + Intergenic
951818015 3:26777009-26777031 ATTTCTCAAAGAACTAAAAATGG + Intergenic
953300296 3:41767790-41767812 TTTTCTCAAAAGCCTTAAAAAGG + Intronic
953478291 3:43225397-43225419 TTTTCTCAAAAAATTAAAAATGG - Intergenic
956095257 3:65709194-65709216 TTTTTTCCAAGTAATGAAAAGGG + Intronic
956165907 3:66398131-66398153 TCTTCACAAAGGCATCAAACTGG + Exonic
956559734 3:70561733-70561755 ATTTCTCAAAGAATTAAAAATGG - Intergenic
956641738 3:71422284-71422306 TTTTCTAATAGGAGTGAAAAGGG - Intronic
956869848 3:73406223-73406245 TTTTCTCAAAGGGAGAAACATGG - Intronic
957144517 3:76406465-76406487 TTTTCTTAAGGGAAAAAAAATGG - Intronic
957216470 3:77326631-77326653 TTTTTTCAAACAAATCACAAAGG + Intronic
957330866 3:78761064-78761086 TAGTCTAACAGGAATCAAAAAGG + Intronic
957417350 3:79923037-79923059 TTTTCTTAAAGGCAACAAAATGG + Intergenic
957628732 3:82690267-82690289 TTTTATAAAAGTAATCAAGAGGG - Intergenic
957662759 3:83183113-83183135 TATACTCAAAGGAATGTAAATGG + Intergenic
957770719 3:84688555-84688577 TTTGCACAAAGTAATCACAAAGG + Intergenic
957907171 3:86572222-86572244 TTTTAAAAAAGAAATCAAAATGG - Intergenic
958148893 3:89663580-89663602 TCTTCTCAAAGGCATATAAAAGG - Intergenic
958445799 3:94213473-94213495 ATTACTCAAAGAACTCAAAAGGG + Intergenic
958626946 3:96638555-96638577 ATTTCTCAAATGACTTAAAATGG + Intergenic
958835680 3:99141872-99141894 AGTTTTAAAAGGAATCAAAATGG - Intergenic
959221035 3:103520165-103520187 TCATCTCAATGGAAGCAAAAGGG + Intergenic
959306751 3:104677050-104677072 ATTTCTCAAAGAACTTAAAATGG + Intergenic
959462180 3:106640893-106640915 TTTCCACTAAGGAGTCAAAATGG - Intergenic
959692480 3:109213178-109213200 TTCTCTCTGAGGAAGCAAAATGG - Intergenic
960396652 3:117145922-117145944 TTTTCTCAAATGAACCTAATAGG + Intergenic
960524356 3:118692418-118692440 TTTTATCAAAAGAAAAAAAAAGG - Intergenic
961196343 3:125004835-125004857 TTTCCTCAAAGGAATGCCAAAGG - Intronic
961929715 3:130520295-130520317 GTTTTTCAAAGGAATTTAAAAGG + Intergenic
962342901 3:134600292-134600314 TCTTCTCAAAGGACTTGAAAAGG - Intronic
962442278 3:135432212-135432234 TTTTTTGAAATGAATGAAAATGG + Intergenic
962569627 3:136699735-136699757 TTTTCTGAAAGGATACACAAAGG - Intronic
962607055 3:137041194-137041216 TTTTCCAAAATGAATCACAAAGG - Intergenic
962921489 3:139954148-139954170 TTTTCTCTTAGGAAACAACAGGG - Intronic
963482828 3:145898329-145898351 CTTTCTCACAGTGATCAAAATGG - Intergenic
963609011 3:147441855-147441877 TTAGCACAAAGGAATCAAAAAGG - Intronic
964330566 3:155597758-155597780 TTTCCTCAAAGAAATCAAGGAGG + Intronic
965049743 3:163630451-163630473 ATTTCTCAAAGAACTTAAAATGG - Intergenic
965734593 3:171807666-171807688 ATTTCTCAAAGAACTCAAAACGG + Intronic
965755061 3:172017381-172017403 ATTTCTCAAAGAACTTAAAACGG + Intergenic
966018555 3:175176626-175176648 TTTTCTCAAGGGAAAGAAAGAGG - Intronic
966024710 3:175262310-175262332 TGTTCTTAAGGGAAACAAAAAGG - Intronic
966440454 3:179939081-179939103 ATTTCCCAAAGGAATTCAAATGG - Intronic
966478602 3:180379280-180379302 ATTTCTCAAAGGAAGATAAATGG - Intergenic
968198255 3:196728727-196728749 TTTTGTCAAAGGAATCAAACCGG - Exonic
968297657 3:197590060-197590082 TTTTCTAGAAGGAATTACAAGGG + Intergenic
968331897 3:197877831-197877853 TTTGTCCATAGGAATCAAAAAGG - Intronic
969698511 4:8750144-8750166 ATTTCTCAAAGAAACAAAAATGG + Intergenic
970117892 4:12719750-12719772 TTTTTTCAAAGGAATCTAGTTGG - Intergenic
970269708 4:14332518-14332540 TTTTCTTAAAAAAATCAAATAGG + Intergenic
971668888 4:29529819-29529841 ATTTCTCAAAGAACTTAAAATGG + Intergenic
972455732 4:39252623-39252645 TTTTCTAAAAGTATTTAAAAGGG - Intronic
972707781 4:41562231-41562253 ATTTTTAAAAGGAAGCAAAAAGG - Intronic
973065696 4:45789017-45789039 CTTTCTGAAAGAAATTAAAATGG + Intergenic
973701068 4:53537863-53537885 TTTCCTGAAAGGAAGCAAACTGG - Intronic
973729084 4:53805750-53805772 TTTCCTTAAAGAAATAAAAAAGG + Intronic
973752481 4:54035934-54035956 ATTGGTCAAAGAAATCAAAAGGG - Intronic
973865683 4:55110555-55110577 TTTTTTCATAGGTATAAAAATGG - Exonic
973937345 4:55861153-55861175 TTTTTTCAAAGCAATCAAGTTGG + Intronic
973941628 4:55916785-55916807 TCTTCTCATAGGAGCCAAAATGG + Intergenic
974420637 4:61668713-61668735 TTTTCTCAAAAAAAAAAAAATGG + Intronic
974496550 4:62635778-62635800 ATTTCTCAAAGGACTTAAAATGG + Intergenic
974743053 4:66032563-66032585 GTTTCTCAAAAAAATAAAAATGG + Intergenic
975155957 4:71073358-71073380 TTTTTGTAAAGTAATCAAAAAGG + Intergenic
975161482 4:71129559-71129581 ATTTCTTAAAGAACTCAAAATGG + Intergenic
975253151 4:72202761-72202783 ATTTCTCAAAGAACTAAAAATGG - Intergenic
976118550 4:81754920-81754942 TGTTCTCAAAGCAAGCAAATAGG + Intronic
976368946 4:84265006-84265028 ATTTCTCAAAGAACTAAAAATGG + Intergenic
976450092 4:85178998-85179020 ATTTCTCAAAGAATTGAAAATGG - Intergenic
976579484 4:86718913-86718935 TTTGTTCAAAAGTATCAAAATGG - Intronic
977517695 4:98042522-98042544 TTTTTTGAAATGAATAAAAATGG - Intronic
977623499 4:99164131-99164153 GTTTCTCAAGAGAATCAAAAGGG - Intergenic
978230069 4:106386797-106386819 TTTTTTGCAATGAATCAAAAAGG - Intergenic
978516535 4:109574627-109574649 TTTTCACAGAGCAGTCAAAAAGG + Intronic
978705912 4:111710939-111710961 TATTCTCTAAGGAATCAATATGG - Intergenic
979025142 4:115561948-115561970 TTTATTCAAAGATATCAAAAAGG + Intergenic
979111206 4:116760154-116760176 TTTTCTCAGAGGCATTAAAATGG + Intergenic
979500768 4:121437168-121437190 TTTTTTCAAAGGAATCCCAGGGG - Intergenic
979534395 4:121803227-121803249 TTTTCTTAAAGGTTTCTAAAAGG + Intronic
979772046 4:124538570-124538592 TTTAATCAAATGATTCAAAAAGG + Intergenic
980189318 4:129503064-129503086 TTTTCTCAAAGAACTAAAAATGG + Intergenic
980222440 4:129936524-129936546 CTTTCTCAGAGAAATCGAAATGG + Intergenic
980236942 4:130120464-130120486 ATTTCTCAAAGAACTAAAAATGG + Intergenic
980272029 4:130596639-130596661 TTTCCCCAAAGGCAACAAAATGG - Intergenic
980319787 4:131256346-131256368 ATTTCTCACAGAAATCATAAGGG - Intergenic
980418986 4:132534584-132534606 ATTTCCCAAATGAATTAAAATGG + Intergenic
980421144 4:132563172-132563194 TTTTCTCAAACAAAGAAAAAGGG - Intergenic
980532961 4:134078371-134078393 TGTACTTAAAGGAATCTAAAAGG + Intergenic
980752565 4:137110965-137110987 TGTTCTCAAAGAAATAATAAAGG - Intergenic
980796369 4:137688939-137688961 TTTTTTTAAATGAATCTAAAGGG - Intergenic
980875761 4:138660395-138660417 TTTTCTGATATGAAGCAAAATGG - Intergenic
980883962 4:138741844-138741866 TTTGATCATAGGAATCAGAAAGG - Intergenic
981294844 4:143119851-143119873 TTTTCTCAAAGAAAAAAAAGAGG - Intergenic
981361430 4:143850182-143850204 TTTTCTCAAGTGAAGAAAAAGGG - Intergenic
981372177 4:143971175-143971197 TTTTCTCAAGTGAAGAAAAAGGG - Intergenic
981381257 4:144074375-144074397 TTTTCTCAAGTGAAGAAAAAGGG - Intergenic
981525847 4:145706549-145706571 TTTTCTTTAAGGAATCAAAATGG - Intronic
981663681 4:147196895-147196917 TTTTATTAAAAGAATCATAAAGG + Intergenic
982039151 4:151377872-151377894 TTTTTTGAAATGAATGAAAATGG + Intergenic
982305266 4:153923955-153923977 TTGTCTCAAAGGAAAAAAAAAGG - Intergenic
982489706 4:156014581-156014603 TTTTGTCAAAAGAAACAGAAGGG + Intergenic
982712623 4:158772086-158772108 TTTCCTCAAAGCTATGAAAAGGG - Intronic
982997380 4:162366765-162366787 ATTTCTCAAAGAACTAAAAATGG - Intergenic
983016090 4:162614638-162614660 TTTTATCAAAGTAATTAAACTGG + Intergenic
983190964 4:164753048-164753070 TTTTATCAAGGGTTTCAAAAGGG - Intergenic
983444907 4:167837461-167837483 TTTTTTAAAAGGAATCATAAAGG - Intergenic
983492446 4:168403848-168403870 TTTTCTAAAATGCAACAAAATGG + Intronic
983548158 4:168985482-168985504 ATTTCTCAAAGAACTTAAAATGG + Intronic
983585435 4:169349130-169349152 TTTTGTCAAAGGAATGGACAAGG + Intergenic
983677081 4:170308290-170308312 CTTTCACAGAGGAAACAAAAAGG - Intergenic
984031662 4:174612138-174612160 TTTCCTTTAAGGAATCAAACTGG + Intergenic
984407694 4:179354911-179354933 TTCTCTCTAAGGATCCAAAACGG + Intergenic
984603920 4:181762103-181762125 TTTTCTCACAGAATTCAGAAGGG + Intergenic
984975126 4:185223463-185223485 TTTTGCCAAAGGAATCAAACAGG - Intronic
985001532 4:185489016-185489038 ATCTCTCAAGGGAATTAAAATGG - Intergenic
985813606 5:2110421-2110443 TTTTCCCAAAAGAATCAATTTGG - Intergenic
985899244 5:2774636-2774658 TTTCCTCAAATAAATTAAAACGG + Intergenic
986408615 5:7452647-7452669 ATTTCTCAAAGAATTCAAAGTGG - Intronic
986648455 5:9941040-9941062 CTTTCTCAAAGGAAGACAAAAGG + Intergenic
987086954 5:14479245-14479267 TTCTCTCCTAGGAATAAAAAAGG - Exonic
987195767 5:15524457-15524479 TTTTCTCTTTTGAATCAAAATGG + Intronic
987581199 5:19794902-19794924 ATTTCTGAAAGGTATGAAAAAGG + Intronic
987794551 5:22609137-22609159 CTTTCTCCAAGGCATCAAATCGG + Intronic
988021089 5:25623014-25623036 TATTCCCAAAGGAATAAAAATGG - Intergenic
988173057 5:27683799-27683821 CTTTATCAAAGGCATCAAAAGGG - Intergenic
988652640 5:33169330-33169352 ATGTCTCAAAGTATTCAAAAGGG - Intergenic
988961602 5:36376580-36376602 TTTTCTCAGAGGAATCATCCAGG - Intergenic
989189564 5:38657175-38657197 TTTTCCTTAAGGAGTCAAAAGGG - Intergenic
990048123 5:51459773-51459795 TTTTGTCAGAGGAAGCAAAGAGG + Intergenic
990049352 5:51477625-51477647 TTTTCCAAAAGCAATCAAACTGG - Intergenic
990108076 5:52289130-52289152 TTTTCTCAAAGGACTTGAATAGG + Intergenic
990361127 5:55020972-55020994 ATTTTTCAAAGGAATGTAAAAGG + Intronic
990689159 5:58343387-58343409 TTTTCTCAGAGAAATAGAAATGG + Intergenic
991959383 5:72029023-72029045 ATTTCTCAAAAGAATAAAAACGG - Intergenic
992070908 5:73148019-73148041 ATTTCTCAAAGAAATTAAATCGG + Intergenic
992142274 5:73810749-73810771 ATTTCTCAGAGGCATCAGAATGG - Intronic
992240969 5:74768975-74768997 TTTTCTCATGGTAATCCAAACGG - Exonic
992347191 5:75891690-75891712 ATTTCTCAAATGAAAGAAAATGG - Intergenic
992554964 5:77893977-77893999 TTGATTCAAAGGAATAAAAATGG + Intergenic
993094618 5:83467180-83467202 TTTTGTCAATAGAATAAAAATGG + Intergenic
993140410 5:84025921-84025943 TTTTCTTAAAGGAATTAATTGGG + Intronic
993147876 5:84119231-84119253 TTTTTTCACAGAAATGAAAATGG + Intronic
993431490 5:87837790-87837812 TCTTCTCAAACTAATCCAAAAGG - Intergenic
993994118 5:94700061-94700083 TCTGCTTAAAGGAATCCAAAGGG + Intronic
994362574 5:98870086-98870108 TTTTTTTAAAGGAATAATAATGG - Intronic
994891853 5:105646716-105646738 CTTTCTAAAAGGAATTAGAAAGG - Intergenic
994973237 5:106770677-106770699 TTTTCACAATGTAATGAAAAAGG + Intergenic
995596777 5:113755881-113755903 GTTTTTCAAAGGAAGGAAAATGG + Intergenic
995830526 5:116349692-116349714 TTTTCTCAGAGGAAATAAATAGG + Intronic
996067769 5:119098863-119098885 TTTTGTGTAAGGAATCAAAATGG + Intronic
996247793 5:121286133-121286155 CTTTCTGGAAGGAATAAAAAGGG - Intergenic
996815018 5:127565059-127565081 TTTTGGCAAAGGAAAAAAAAAGG + Intergenic
996824659 5:127668386-127668408 TTTGTTCAAGGGAATCAGAATGG + Intergenic
996919645 5:128752759-128752781 TATTCTAAAATGAATCAGAAAGG - Intronic
997139360 5:131362302-131362324 ATTTTTCTCAGGAATCAAAAAGG - Intronic
997153558 5:131526559-131526581 TTGTATCAAATGAAGCAAAAAGG + Intronic
998433525 5:142087322-142087344 TTTTCTAAAAGTTACCAAAAAGG - Intergenic
998940477 5:147276840-147276862 TTTTCTCAAAAGAAAAAAATTGG - Intronic
999936802 5:156495406-156495428 CTTTCTCACAAGTATCAAAACGG + Intronic
1000808072 5:165822425-165822447 TTTTCTAAAAGAAATTAAAGAGG - Intergenic
1001166380 5:169372789-169372811 TTTTCTCAAAGAACTAAAAGTGG + Intergenic
1001356253 5:171026497-171026519 TTCTGTTAAAGGAATGAAAAGGG - Intronic
1001439004 5:171723846-171723868 TTGTCTCTAAGGAAGAAAAAAGG - Intergenic
1001730078 5:173946989-173947011 TATTCTCATAGGTATCATAAGGG - Intronic
1001987216 5:176084944-176084966 TTGTCTCAGAGGACTCACAATGG + Intronic
1002229652 5:177753203-177753225 TTGTCTCAGAGGACTCACAATGG - Intronic
1002265693 5:178030574-178030596 TTGTCTCAGAGGACTCACAATGG + Intronic
1002270425 5:178068177-178068199 TTTTTTCAAAGGAAAGAAATTGG - Intergenic
1002773888 6:312260-312282 AATTCTGAAAGGAATGAAAATGG - Intronic
1003230289 6:4245859-4245881 TTTTCCCAAAGACATAAAAATGG - Intergenic
1003478415 6:6507218-6507240 TGTTCTCAAATGAAACAAAATGG - Intergenic
1003737627 6:8894793-8894815 GTTTCTTAATGGAAACAAAAAGG - Intergenic
1003811290 6:9784911-9784933 TTTTCTCAAAGAAAAGAATAGGG - Intronic
1003994664 6:11527141-11527163 TTTTAACAAAAGAATCTAAAAGG + Intergenic
1004101767 6:12619476-12619498 ATTTCTCAAATAAATCTAAATGG + Intergenic
1004318320 6:14611578-14611600 TTTTCACAAAGAAAACAAATTGG - Intergenic
1004502803 6:16224113-16224135 TTTTATAAAAGGCATCAAAGGGG - Intergenic
1004568046 6:16817806-16817828 TCATCTCCAAAGAATCAAAATGG + Intergenic
1004855381 6:19744290-19744312 TTTTGTCAAAGGCCTAAAAAAGG - Intergenic
1004992719 6:21156634-21156656 TTGTCTGAAAGGAATTGAAACGG + Intronic
1006485433 6:34336367-34336389 TTTTCTCAAAAGAAGACAAATGG - Intronic
1006534177 6:34684355-34684377 TTTCCTCAATGGAAACACAATGG + Intronic
1007865612 6:44966208-44966230 ATTTCTTAAAGGAATAGAAAAGG - Intronic
1008429308 6:51396933-51396955 TTTTCTCAGGGGTATCAAGAAGG + Intergenic
1008471013 6:51885275-51885297 TTTTCTTAAAGGAAAAGAAAAGG - Intronic
1009575642 6:65455161-65455183 TTTTATAAAAGAAATCAAAGAGG - Intronic
1009667720 6:66705158-66705180 TTTGTTGAAAGGAATGAAAAAGG + Intergenic
1009796613 6:68477538-68477560 TTTCCTTAAAGGAAACAAAGAGG - Intergenic
1010178723 6:73059007-73059029 ATTTCTCAAAGAACTCAAAATGG + Intronic
1010520622 6:76830248-76830270 TTTTCTAAAAGTCAACAAAATGG + Intergenic
1011359469 6:86507607-86507629 TTTTTTCAAACAAATGAAAATGG - Intergenic
1011952641 6:92985810-92985832 TTTCCTCAACTGAACCAAAAAGG + Intergenic
1012020585 6:93913465-93913487 TTTTTTCAAAGGAATAATATGGG - Intergenic
1013321348 6:108992956-108992978 TTTACCCAAAGGAGTAAAAATGG + Intronic
1013352540 6:109318627-109318649 TTTTCTCCAAGGACTCGGAAGGG - Intergenic
1013905476 6:115212172-115212194 ATTTCTCAAATGACTAAAAATGG + Intergenic
1014683278 6:124461481-124461503 TTTTCTAAAAGTAATTAAGAAGG - Intronic
1014906989 6:127042447-127042469 ATTCCTCAAAGAAATTAAAATGG + Intergenic
1015017686 6:128434070-128434092 TTGTCTAAATGGAATCAAGATGG - Intronic
1015234026 6:130950284-130950306 TTTTCCCAAAGGAAACAACTTGG - Intronic
1015297932 6:131620037-131620059 TTTTTTAGAAGGAAGCAAAAGGG - Intronic
1015871702 6:137782093-137782115 TTCTCTCAAAGAAAAAAAAAAGG - Intergenic
1016016303 6:139190047-139190069 TTTTCTGAAAGGAATCCCCAAGG - Intergenic
1016209670 6:141514834-141514856 TATTCTCAAACAATTCAAAAAGG + Intergenic
1016336436 6:143010045-143010067 TTTATTCAAAAGAATAAAAAAGG - Intergenic
1016455133 6:144222920-144222942 TTGTCTCAGAGGAAAAAAAAGGG - Intergenic
1016504105 6:144758393-144758415 TTTTCTTAGAGGAAGAAAAATGG - Intronic
1017173088 6:151476205-151476227 TTTTCTAAAAGGTTTAAAAATGG - Intergenic
1017390721 6:153936389-153936411 TCTGCTCAAAGAAATCAGAAAGG - Intergenic
1017404061 6:154097524-154097546 TTTTGTGAATGAAATCAAAATGG + Intronic
1017573102 6:155769464-155769486 TTTTTTGAAAGAAATAAAAACGG - Intergenic
1018073464 6:160187808-160187830 TTTACTCAAAGTAAGAAAAATGG + Intronic
1018622145 6:165740051-165740073 GTTACTCAAAGGACTAAAAATGG + Intronic
1018700527 6:166422575-166422597 TTTTCTCAAAGGCAAGAAATTGG + Intronic
1018842685 6:167529538-167529560 TTTTCACAAGGGCATGAAAATGG - Intergenic
1019825924 7:3284183-3284205 TTTTTTCAAATGAATGAAAGTGG + Intergenic
1020619475 7:10500687-10500709 TTATCTCAATAGAAGCAAAAAGG + Intergenic
1021205693 7:17777233-17777255 TATTCTGAATGAAATCAAAATGG - Intergenic
1021271463 7:18592125-18592147 TTGTCTCAAATGAAGAAAAAAGG + Intronic
1021399242 7:20190665-20190687 TTTTATCAAACGAAAAAAAATGG + Intronic
1021529551 7:21629106-21629128 TTTTCTGAAACAAATTAAAATGG - Intronic
1021834806 7:24659396-24659418 ATTTCTCAAAGAACTTAAAACGG - Intronic
1022171106 7:27832576-27832598 TTATATCAAAGTAATGAAAATGG + Exonic
1023214249 7:37844913-37844935 ATTTCTCAAAGAATTTAAAATGG - Intronic
1023453332 7:40311836-40311858 TTTTAACAAATGAATGAAAATGG - Intronic
1024483750 7:49893065-49893087 CCTCCTCAAAGGAATAAAAAAGG - Intronic
1024727322 7:52212782-52212804 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1026414268 7:70161850-70161872 TTTTCTAAAAGGAATTACAGGGG + Intronic
1026513298 7:71045376-71045398 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1026672020 7:72399027-72399049 TTTTCTCAAAGTTCTCACAAGGG - Intronic
1026985128 7:74550188-74550210 TTGTCTCAAAAAAATAAAAAGGG + Intronic
1027814959 7:82956770-82956792 TATTCTCAAGGGACTCAAAAAGG - Exonic
1027926280 7:84467769-84467791 TTCTATCAAAGGAAATAAAAAGG - Intronic
1027952133 7:84830261-84830283 TTTTTTCAAAAGAATCCAAATGG + Intergenic
1027999807 7:85479365-85479387 TTTTCTCTTAGAAATTAAAAAGG - Intergenic
1028382843 7:90217815-90217837 GTTTCTCAAAAGACTAAAAATGG - Intronic
1028915573 7:96255377-96255399 TTTTCTCTAATGAATTGAAAAGG + Intronic
1029606923 7:101604875-101604897 CTGTCTCTAAGGAATAAAAAAGG - Intergenic
1029991979 7:104970801-104970823 GTTTCTAACAGAAATCAAAAGGG - Intergenic
1030433155 7:109479162-109479184 TTTACTCAAAGGAAATAAAAAGG - Intergenic
1030868152 7:114724860-114724882 TTATCTCAAAAGAAAAAAAAAGG - Intergenic
1031052478 7:116957932-116957954 TTTTCCAAAAGGAATGAAAACGG - Intronic
1031129468 7:117815250-117815272 TTTTCACCATGGAATCAAAATGG - Intronic
1031181995 7:118431122-118431144 TTTTCTCAAAGAACTTAAAATGG - Intergenic
1031352415 7:120751107-120751129 ATTGCTCAAAAGAATAAAAAAGG + Intergenic
1031433343 7:121701130-121701152 TTTACTCAAAAGAATCACTAGGG - Intergenic
1031494279 7:122426950-122426972 TTTTCTAAAAGGTATCCAGAAGG - Intronic
1031592964 7:123615948-123615970 ATATCTCAAAGCAATAAAAAAGG - Intronic
1031728933 7:125273564-125273586 TTTTTTGAAATGAATGAAAATGG + Intergenic
1032511917 7:132479425-132479447 TTTCCTAAAAGGACTCAAAAGGG + Intronic
1033573810 7:142660050-142660072 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1033792733 7:144811548-144811570 TTTTATCAGAGGAAACAAATCGG + Intronic
1033880789 7:145880874-145880896 ATTTCTCAAAGAACTTAAAAGGG - Intergenic
1034010342 7:147522693-147522715 GTTTCTCAATGGATTTAAAAAGG - Intronic
1034344346 7:150377095-150377117 TTTTCTCAGTGTAAACAAAAAGG - Intronic
1034783854 7:153907050-153907072 ATTTCTCAAAGAACTAAAAATGG - Intronic
1035849201 8:2897310-2897332 TTTTCTTAATGAAATGAAAAGGG + Intergenic
1036219999 8:6913484-6913506 ATTCCTCCAAGGAATCAAATGGG + Intergenic
1036635058 8:10543536-10543558 ATTTGTTAAAGGAAACAAAATGG - Intronic
1037063430 8:14544975-14544997 TTTTATTAAAGGTTTCAAAAGGG - Intronic
1037230693 8:16654589-16654611 TTTTCTCTAAGAAATTAAAGTGG + Intergenic
1037628098 8:20625996-20626018 TGTTCTAATAGCAATCAAAATGG + Intergenic
1038464454 8:27748367-27748389 TTTTCTAAAGGGAATTAAACTGG - Intronic
1039190179 8:34964772-34964794 AGTTCTCAAGGGAACCAAAATGG - Intergenic
1039496937 8:37987325-37987347 TTTTCCCAATGGAATGATAATGG - Intergenic
1040064955 8:43138260-43138282 TTTTTTCAAAGGAATCCGAAGGG - Intergenic
1040372792 8:46794126-46794148 TTTCCACAAAGAAATCAGAATGG + Intergenic
1040717411 8:50273917-50273939 TTTGATGAAATGAATCAAAAAGG - Intronic
1040889427 8:52301201-52301223 TTTCCTCAAAGGAGTTAAATAGG - Intronic
1041315339 8:56555543-56555565 TTTTCACAGAGCAAGCAAAAAGG + Intergenic
1041664839 8:60433338-60433360 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1041834991 8:62201638-62201660 AGTTCTCAAAGGAGCCAAAATGG + Intergenic
1042131416 8:65590169-65590191 TTTTCTGTAAAGGATCAAAAAGG - Intergenic
1042197997 8:66249923-66249945 TTTTATTAAGGGATTCAAAAGGG - Intergenic
1042532990 8:69833615-69833637 TTTTCTAAAAGGAAAAAAGAAGG + Intronic
1043195052 8:77281416-77281438 TTTTCACAGAGCAGTCAAAAGGG + Intergenic
1043546858 8:81325062-81325084 ATTTCTCAAAGAACTAAAAATGG - Intergenic
1043588945 8:81805469-81805491 TTTAATCAAGAGAATCAAAAAGG + Intronic
1043914721 8:85908331-85908353 GTTTATCAAAGGAACCAATATGG + Intergenic
1044083860 8:87918955-87918977 TTTTCTCAAAGAAAATTAAATGG + Intergenic
1044227269 8:89733699-89733721 TTTGGTCAAAGAAATTAAAAGGG + Intergenic
1045558179 8:103235205-103235227 TTGATTCAAAGGAATCAGAATGG + Intergenic
1045680966 8:104659441-104659463 ATTTCCCAAAGGAAGAAAAATGG - Intronic
1045741929 8:105370810-105370832 TTTGCTCAAAGGAATCTAGCTGG + Intronic
1045866729 8:106874758-106874780 ATTTCTCACAGGATTCAAAGTGG - Intergenic
1045914550 8:107451568-107451590 TTTTCTCAAAGTGACTAAAATGG + Intronic
1045936231 8:107682386-107682408 ATTTCTCAAAGAACTTAAAACGG - Intergenic
1046106268 8:109670841-109670863 TTTTCTCTAAAGAAACAAGAGGG + Intronic
1046352771 8:113037908-113037930 TTGTGGAAAAGGAATCAAAATGG + Intronic
1046354472 8:113062166-113062188 TTTTCTCTAAGCATTCAAATTGG + Intronic
1046986693 8:120396906-120396928 TTCTCCCAGAGGAATGAAAATGG + Intronic
1047101741 8:121684069-121684091 ACTGCTCTAAGGAATCAAAAGGG - Intergenic
1047264291 8:123291465-123291487 TTTTTTTAAAGGTATCAAAGTGG - Intergenic
1047541515 8:125771076-125771098 TTTTCCTAAAGGAAACAAACAGG - Intergenic
1047675709 8:127199016-127199038 ATTTCTCAAAGGACTAAAAACGG - Intergenic
1048147037 8:131855287-131855309 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1048958976 8:139559980-139560002 TTATCAGAAAGGAACCAAAAGGG - Intergenic
1049980421 9:899229-899251 TTTTTTTCTAGGAATCAAAAAGG - Intronic
1050056028 9:1655560-1655582 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1050648104 9:7744048-7744070 GTTTCTCAAAGAACTTAAAATGG - Intergenic
1050728933 9:8685202-8685224 ATCTTTCAAAGGAAACAAAAAGG + Intronic
1050947052 9:11537382-11537404 TTTTCTCAAAGCAATTAAATGGG + Intergenic
1050965272 9:11793246-11793268 TTTTATCATAAGAAACAAAATGG + Intergenic
1051004559 9:12327480-12327502 TTTTCTCAAAGACATACAAATGG - Intergenic
1051218382 9:14822737-14822759 TTTTCCAAAATGAATCAAGATGG - Intronic
1051940634 9:22501459-22501481 TTTTCTAAAAGAAAAAAAAAAGG - Intergenic
1052201163 9:25782403-25782425 TGTTATCAAAGGACTCAAACAGG + Intergenic
1052313719 9:27094942-27094964 TTATCCCCAGGGAATCAAAAGGG + Intergenic
1052540122 9:29800423-29800445 TTTTTTCTAAGGAAACCAAAAGG - Intergenic
1052581774 9:30366159-30366181 ATTTCTCAAAGAACTTAAAACGG - Intergenic
1052693853 9:31851137-31851159 TGTTCTAAAAGAAATCAAAAGGG + Intergenic
1052743926 9:32421151-32421173 TTTTCTCCATGGAGTCAAAATGG + Intronic
1052886409 9:33652456-33652478 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1053593702 9:39537962-39537984 TTTTAAAAAAGGAAACAAAATGG + Intergenic
1053851488 9:42293013-42293035 TTTTACAAAAGGAAACAAAATGG + Intergenic
1054572604 9:66827304-66827326 TTTTTAAAAAGGAAACAAAATGG - Intergenic
1055085481 9:72309426-72309448 CTTTCCCAAAGGAATAAAGATGG - Intergenic
1055153643 9:73034739-73034761 TTTTCTAAAAGGAGCCAATACGG + Intronic
1055789386 9:79906224-79906246 ATTTTTTAAAGGAATAAAAATGG + Intergenic
1055850635 9:80624865-80624887 TTTTCTCAAGGGACTCTTAATGG - Intergenic
1055919580 9:81444640-81444662 TTTTCTCAAAAAATTAAAAATGG + Intergenic
1055972710 9:81927862-81927884 TTTTCTCAAAAAAATCAAATTGG + Intergenic
1055974463 9:81942934-81942956 TTTTCTCAAAAAAATCAAATTGG + Intergenic
1055984833 9:82047353-82047375 TTGTCTCAAAAGAAAAAAAAAGG - Intergenic
1056078660 9:83066785-83066807 TTATCTCAAAGGAATATAATAGG - Intergenic
1056421681 9:86434395-86434417 TTTAGTTAAAGGAAGCAAAATGG - Intergenic
1056478074 9:86972252-86972274 TTTTTTCAGAGGACTTAAAATGG + Intergenic
1056878717 9:90366773-90366795 TTTTATAAAAGTAATCAAGAAGG - Intergenic
1057594906 9:96407331-96407353 TTTTCTCATGGTAATCCAAACGG - Intronic
1058052839 9:100423741-100423763 GTCTCTAAAAGGAATAAAAAAGG + Intergenic
1058336912 9:103841194-103841216 TTATCTGAAAGGCAACAAAAGGG - Intergenic
1058522547 9:105825881-105825903 TTTTCTGAAACAAATGAAAATGG - Intergenic
1058818563 9:108708155-108708177 TGTTTTAAAAGGAATTAAAATGG + Intergenic
1059199285 9:112399265-112399287 TTTTATTAAAGGTTTCAAAAGGG + Intronic
1059868932 9:118549200-118549222 ATTTCTCAAAGTACTTAAAATGG + Intergenic
1059873049 9:118599609-118599631 TTTTCTCAAATAACTCACAATGG - Intergenic
1061357216 9:130115453-130115475 TTTTTTAAAAGAAAACAAAAAGG - Intronic
1061650687 9:132046898-132046920 TTTTGGCTAAGGAATCAAAAAGG + Intronic
1062226633 9:135456057-135456079 TTGTATCAAAGGAATAAAAGTGG + Intergenic
1185922273 X:4106925-4106947 GTTTCTCAAAAAAATAAAAATGG - Intergenic
1186086722 X:5998459-5998481 TTTTCTTAAAGGAACCATAGGGG - Intronic
1186433897 X:9527315-9527337 TTTCCTCAAAGGAATCTGTAGGG - Intronic
1187192451 X:17047929-17047951 TTTTCTGAGAGAAATTAAAATGG + Intronic
1187317275 X:18207423-18207445 ATGTCTCAATGGAAACAAAATGG - Intronic
1187549699 X:20289877-20289899 TTTTGTCACAAGGATCAAAAAGG - Intergenic
1187820665 X:23284583-23284605 TTGTCTCAAAACAATGAAAATGG + Intergenic
1188140892 X:26549336-26549358 TTTTCTCAAAAGTGTCCAAATGG - Intergenic
1188288528 X:28360025-28360047 GGTTCTTACAGGAATCAAAATGG - Intergenic
1188340981 X:29001508-29001530 TTTTCACAGAGGAAAAAAAATGG + Intronic
1188384654 X:29541374-29541396 GTTTCTCAAAGAACTTAAAATGG + Intronic
1188671431 X:32886731-32886753 CTGTCTAAAAGGAAACAAAATGG + Intronic
1188826298 X:34839604-34839626 ATTTCTCAAAGAACTTAAAAAGG - Intergenic
1188961491 X:36498092-36498114 ATTTCTCAAAGAACTAAAAATGG + Intergenic
1189154407 X:38742165-38742187 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1189669322 X:43391097-43391119 TCTACGGAAAGGAATCAAAACGG + Intergenic
1189709263 X:43792772-43792794 TTTTCTCAAAGAAGTAAAAATGG + Intronic
1190384894 X:49875489-49875511 TTATCTCAGGGGAATAAAAATGG + Intergenic
1190802246 X:53801577-53801599 TTGGGTCAAAGAAATCAAAAAGG + Intergenic
1190980211 X:55450955-55450977 TTTCCTCAATGGAGTAAAAATGG + Intergenic
1190988789 X:55524176-55524198 TTTCCTCAATGGAGTAAAAAAGG - Intergenic
1191055864 X:56239806-56239828 TTTTTTAAAAGAAAACAAAATGG - Intronic
1191090920 X:56620008-56620030 TTTTTTAAAAGAAATGAAAATGG - Intergenic
1191574277 X:62678744-62678766 TTTTCTCAATGGGAATAAAAGGG - Intergenic
1191819702 X:65291299-65291321 TTTATTCAAAAGAATTAAAATGG + Intergenic
1191836005 X:65462710-65462732 ATTTCTCAAAGAACTTAAAATGG + Intronic
1192372029 X:70522239-70522261 CTTTCTCACAGGAATCACTAAGG + Intergenic
1193270421 X:79523228-79523250 TTATCTCAAATAAATCAGAATGG + Intergenic
1193287931 X:79736063-79736085 ATTTCTCAAAAGAAATAAAATGG + Intergenic
1193450051 X:81654748-81654770 ATTTCTCAAAAGAAGAAAAAGGG - Intergenic
1193586000 X:83322165-83322187 TTTTCTCACACCAGTCAAAATGG + Intergenic
1193648446 X:84098562-84098584 TTTTCTAAATGGAAAGAAAATGG - Intronic
1194059689 X:89181731-89181753 TTTTTTCAAAGGAGTCAAAGGGG + Intergenic
1194118212 X:89928801-89928823 TTTTGTAAAAGGTATAAAAAGGG + Intergenic
1194245459 X:91506137-91506159 GTTTCTCAAAGAACTTAAAATGG + Intergenic
1194259543 X:91676901-91676923 TTTTCTCAAATGATTTAAAATGG - Intergenic
1195008074 X:100706398-100706420 TTTTCTGAAAGGAGTCAGATTGG - Intronic
1195078121 X:101346728-101346750 TTTTCTCTAAGCAACAAAAAGGG - Intronic
1195179905 X:102347750-102347772 ATTTCTCAAAGAACTTAAAATGG - Intergenic
1195241106 X:102952984-102953006 ATTTCTCAAAGGACTTAAAATGG - Intergenic
1195646899 X:107242251-107242273 TTTTTGCAAAGGAATAAAGAAGG + Intronic
1195671701 X:107475386-107475408 TTTTCTCAACAGCATCCAAAGGG + Intergenic
1196110292 X:111940084-111940106 TTTTTTGAAAGAAATGAAAATGG - Intronic
1196425484 X:115564289-115564311 TTTTATCAATTGAATCTAAATGG - Intronic
1196441367 X:115722776-115722798 CTTACTCAAAGGAAACAAATGGG + Intergenic
1196444896 X:115840765-115840787 CTTACTCAAAGGAAACAAATGGG + Intergenic
1196563431 X:117177606-117177628 TTTTTTCAAAGGAATCCCAGGGG - Intergenic
1196584526 X:117414608-117414630 ATTCCTCAAAGAACTCAAAATGG + Intergenic
1197038678 X:121908300-121908322 TTTTTTCAAAGGAGTCCAAGAGG - Intergenic
1198481116 X:137041765-137041787 TTTGCTCAGAGGAATGCAAAGGG + Intergenic
1198531163 X:137550608-137550630 TTTTCCAAAAGGAAACGAAAGGG - Intergenic
1199917276 X:152357139-152357161 ATTTCTCAAAGAACTTAAAATGG - Intronic
1200471091 Y:3586366-3586388 TTTTGTAAAAGGTATAAAAAGGG + Intergenic
1200564428 Y:4747391-4747413 GTTTCTCAAAGAACTTAAAATGG + Intergenic
1200578244 Y:4916094-4916116 TTTTCTCAAATGATTTAAAATGG - Intergenic
1201954170 Y:19603584-19603606 TTTCCTTAAAGTAACCAAAAGGG - Intergenic