ID: 922407332

View in Genome Browser
Species Human (GRCh38)
Location 1:225328810-225328832
Sequence TTTTCTCAAAGGAATCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407328_922407332 24 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407327_922407332 25 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762
922407326_922407332 26 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407332 1:225328810-225328832 TTTTCTCAAAGGAATCAAAATGG 0: 1
1: 0
2: 4
3: 61
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407332 Original CRISPR TTTTCTCAAAGGAATCAAAA TGG Intronic