ID: 922407333

View in Genome Browser
Species Human (GRCh38)
Location 1:225328811-225328833
Sequence TTTCTCAAAGGAATCAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 654}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407326_922407333 27 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407328_922407333 25 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407327_922407333 26 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407333 Original CRISPR TTTCTCAAAGGAATCAAAAT GGG Intronic
904342815 1:29848566-29848588 TTCCCCCAAGAAATCAAAATGGG - Intergenic
905160729 1:36031441-36031463 TTTCTCAAACAAATAAAAACAGG - Intronic
906549225 1:46648410-46648432 TGTCTCAAAACAATAAAAATAGG - Intronic
907695258 1:56719680-56719702 TTTTTCACAGGCATCAAAGTTGG - Exonic
907804426 1:57804152-57804174 TTTCTACAATGGATCAAAATGGG + Intronic
908273745 1:62447503-62447525 GTTCTGAAAGTAAGCAAAATTGG + Exonic
908362555 1:63383111-63383133 TATCTCAAAAAAATAAAAATAGG - Intronic
908644943 1:66267300-66267322 TTTATAAAAAGAAACAAAATAGG + Intronic
908935984 1:69376081-69376103 TTTATTAAAGGAAACAAAAATGG - Intergenic
908965196 1:69752898-69752920 TTTTTCAAAGGGATTAAAAAAGG - Intronic
909077894 1:71075131-71075153 ATCCTAAAAGCAATCAAAATGGG + Intronic
909181023 1:72424216-72424238 TTTCTCAAAGAACTCAAAGCAGG + Intergenic
909431553 1:75593192-75593214 TTTCTCAAAAGACACAAAAATGG + Intronic
909596137 1:77408181-77408203 TTTCTCAAAGAACTTAAAACAGG - Intronic
910030955 1:82722292-82722314 TTTCTCTAAGAAACCAAATTTGG - Intergenic
910138760 1:84002301-84002323 TTTGTCAAAGGTAGCACAATTGG + Intergenic
910278667 1:85474606-85474628 TTTGTCATAGGAGTCAAAACAGG - Intronic
910479640 1:87644405-87644427 TTTGTCAAAGGAAAAAAAAAAGG - Intergenic
910689563 1:89952003-89952025 TTAGTCATAGGAATCAAAAAGGG - Intergenic
910737631 1:90478627-90478649 TTCTTCAAATCAATCAAAATAGG - Intergenic
910764829 1:90771230-90771252 ATTCCCAAAGGAATTAATATGGG - Intergenic
911008376 1:93252565-93252587 TCTCTCAAAGAACTGAAAATAGG - Intronic
911408729 1:97474068-97474090 TTTCTCAAAAAATTAAAAATAGG + Intronic
911756317 1:101560908-101560930 TGTCTCAAAGGAAAAAAAAAAGG - Intergenic
912013425 1:105001307-105001329 TTTTTCAAAGCAATAAAAACAGG + Intergenic
912104831 1:106259288-106259310 TTTCTCAAAACATTAAAAATAGG - Intergenic
912149431 1:106839430-106839452 ATTGTCACAGGAATCAAATTTGG + Intergenic
912737851 1:112165908-112165930 TTTTTTAAAGGAACCAACATGGG + Intergenic
912778038 1:112518736-112518758 TTTCTCAGAGGCATAAAATTAGG + Intronic
912788457 1:112627195-112627217 CTACTTAAAGGAATCAAAATGGG - Intronic
912789107 1:112633870-112633892 TTTCTCAAAGATATACAAATGGG - Intronic
912882323 1:113427861-113427883 TTTTTAAAATGAATCAAAATTGG + Intronic
913415923 1:118607132-118607154 TATCCCAAAGGACTGAAAATAGG - Intergenic
913440356 1:118890287-118890309 TTCCTCAAATGAAGCAAAGTGGG + Intronic
913712129 1:121495907-121495929 TTTATCAATGGAGGCAAAATTGG - Intergenic
913995543 1:143649622-143649644 TTTTTCAAATGACTCAAAAGAGG + Intergenic
914413298 1:147453417-147453439 TTCCTCAAAAGAAACAAAATGGG - Intergenic
914415727 1:147479774-147479796 TTTCTCAAAGGGGTCAGTATTGG - Intergenic
914698300 1:150106427-150106449 TTTCTCAAAAGAATTACAAGTGG + Intronic
914873973 1:151498789-151498811 TTTGTGAAAGGAATCCAAATGGG + Intergenic
916531692 1:165662461-165662483 TTTCTCAATGGAATGACAAGGGG + Exonic
916986116 1:170192584-170192606 TTTCTCAAAAAAGTAAAAATAGG - Intergenic
917072200 1:171164222-171164244 TTTATCCTAGTAATCAAAATTGG + Intergenic
917157352 1:172018913-172018935 TTTCTCAAATAAAGAAAAATTGG - Intronic
917412748 1:174776523-174776545 TTCCCAAAAGAAATCAAAATTGG - Intronic
917421940 1:174873070-174873092 TGTCTCAAAGAAATAAAAAAAGG - Intronic
917697386 1:177540001-177540023 TTTCTCAAAGAACTTAAAAAGGG + Intergenic
917984959 1:180306950-180306972 TTCCTCAAAGAACTGAAAATAGG + Intronic
918233467 1:182556805-182556827 TTTCTCAAAGGAGAGAAAATAGG - Intronic
918474357 1:184907040-184907062 TTTCTAAAAGTAATTGAAATAGG - Intronic
918789574 1:188809014-188809036 TGTCTCAGAGTAATAAAAATAGG - Intergenic
918852784 1:189713919-189713941 TTTCTCAAAGAACTTAAAAGAGG + Intergenic
918937414 1:190940676-190940698 TTTCTCAAAAAATTAAAAATAGG + Intergenic
919150368 1:193689617-193689639 GTTCTCAAAGAACTAAAAATAGG + Intergenic
919394351 1:197025533-197025555 TTTCTCAAAGAACTTAAAATAGG - Intergenic
919394917 1:197034228-197034250 TTTCTCAAAGGAATCAGGCTCGG + Intergenic
919599842 1:199609263-199609285 TTTCTCAAAGAACTTAAAACAGG + Intergenic
919636901 1:200012069-200012091 TTGCAGAAAGGAAACAAAATTGG - Intergenic
921864524 1:220074228-220074250 TTTCTCAAAGGATTAATAGTGGG + Intronic
921875832 1:220195037-220195059 TTTCTAAAAGGACTAAAATTTGG + Intronic
921928035 1:220729291-220729313 TGTCTCTCAGTAATCAAAATGGG - Intergenic
922279232 1:224106989-224107011 TTTCACAAAGCAAGCAAAAAAGG + Intergenic
922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG + Intronic
922409054 1:225351762-225351784 TTTATCAAACGTATCACAATGGG + Intronic
923150304 1:231227265-231227287 TGTCTCAAAGGAAAAAAAACAGG - Intronic
923154546 1:231266655-231266677 TTTCTCAAGGGAACTAAAGTGGG + Intronic
923710456 1:236384827-236384849 TTTCTAGAAGAAATAAAAATAGG - Intronic
924391398 1:243563422-243563444 TTTAATAAATGAATCAAAATGGG + Intronic
1063356908 10:5409754-5409776 GTTCTCAAGTGAATGAAAATTGG + Intergenic
1063996213 10:11622437-11622459 TGTCTCAAAAAAAACAAAATAGG + Intergenic
1064488564 10:15824174-15824196 TTTCTCAAAAAACTAAAAATAGG - Intronic
1064885372 10:20105693-20105715 TTTCTCAAAGGAAGCTGAAATGG + Intronic
1065412882 10:25449616-25449638 TTGGTCAAAGGAAATAAAATAGG + Intronic
1065434620 10:25694154-25694176 TTTCTAAAAAGAGGCAAAATTGG + Intergenic
1067016513 10:42759652-42759674 GTTCTCAAATGAATGAAGATGGG + Intergenic
1067154614 10:43767441-43767463 TTTCTCAAAGAACTAAAAGTAGG - Intergenic
1067158775 10:43804808-43804830 TTTCTCAAATGGAACAAAACCGG + Intergenic
1067393416 10:45887365-45887387 TTTCTTTTAGGATTCAAAATAGG + Intergenic
1067488417 10:46674567-46674589 TTCCTCAAAGAAATAAAATTAGG + Intergenic
1067861739 10:49856495-49856517 TTTCTTTTAGGATTCAAAATAGG + Intronic
1068436495 10:56998756-56998778 TTCCTCAAAGAAATTAAAAATGG + Intergenic
1068713369 10:60157966-60157988 TTACTCAAAGAAATAATAATAGG + Intronic
1068735644 10:60410668-60410690 TGTCTCAAAGAAAAAAAAATTGG - Intronic
1069105858 10:64382497-64382519 TTTATCTAAGGTACCAAAATTGG + Intergenic
1069149754 10:64944972-64944994 TTTCTCAAATAACTGAAAATAGG + Intergenic
1069437994 10:68403252-68403274 TGTCTCAAAAGAAAGAAAATGGG - Intronic
1069942969 10:71967720-71967742 GTTCTCAAAGAACTCAAAGTAGG - Intronic
1070234785 10:74612021-74612043 TTTCTCAAAGAACTAAAAACAGG - Intronic
1070396303 10:76013758-76013780 ATTCTGAAAGGAAAGAAAATAGG - Intronic
1070460086 10:76657682-76657704 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1070572965 10:77655310-77655332 TTTCTCCAAGCAATGAACATAGG + Intergenic
1071168567 10:82835444-82835466 ATTATCAAAGGAAACAGAATGGG + Intronic
1071208947 10:83315956-83315978 TTTCTCAAAGAACTAAAAGTAGG - Intergenic
1071379204 10:85040877-85040899 TTGCTCATAGGAATATAAATTGG - Intergenic
1071613310 10:87051793-87051815 TTTCTCAATGGCATTAACATAGG + Exonic
1071880632 10:89893631-89893653 TATATAAAAGGCATCAAAATTGG - Intergenic
1072062142 10:91823636-91823658 CATCTAAAAGGGATCAAAATGGG - Intronic
1072324101 10:94279653-94279675 TCTCCCAAATGTATCAAAATAGG + Intronic
1072644446 10:97241707-97241729 TGTCTCAAAAAAATAAAAATAGG + Intronic
1072849065 10:98867588-98867610 TTTCTCAAAAAACTAAAAATAGG + Intronic
1073404853 10:103288272-103288294 TCTCTCAAATGAATCAGGATTGG + Intronic
1073627670 10:105116479-105116501 TTTCTCAAAGAACTTAAAACAGG + Intronic
1073749303 10:106505913-106505935 GTTCTCATGGGAATCAAAATAGG - Intergenic
1074278217 10:112024961-112024983 TTTATCAAAGGATTCATTATAGG - Intergenic
1074837113 10:117306511-117306533 TTTAACAAAGGAATTAAAAAGGG - Intronic
1075162765 10:120039469-120039491 TCTCTCATAGGAACCATAATGGG - Intergenic
1075293690 10:121253545-121253567 TTTATCAAAAGAATGAAAAGTGG + Intergenic
1078226143 11:9393256-9393278 TTTATCAAAGTACCCAAAATAGG - Intronic
1078915822 11:15777828-15777850 TTTCTCAAATGAATGGAACTGGG - Intergenic
1079145383 11:17846632-17846654 TCTCTCACAGGATTCAAAAATGG + Intronic
1079544565 11:21617199-21617221 GTTCTCAAAGGACTTAAGATAGG + Intergenic
1080177566 11:29384513-29384535 TTTCTGGAAGGGATCAAATTTGG - Intergenic
1081048118 11:38302022-38302044 TTTCTCAAGGGACAGAAAATTGG - Intergenic
1081050362 11:38332587-38332609 TTTGTCAAATGAATGCAAATTGG - Intergenic
1081096902 11:38947571-38947593 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1081221288 11:40465868-40465890 TTTCTCAAAGAATTAAAAAATGG + Intronic
1081354311 11:42094395-42094417 TTTATCAGAGGAGTGAAAATGGG + Intergenic
1081359421 11:42156133-42156155 TTTCTGAAAGAAATAATAATTGG + Intergenic
1081509873 11:43759534-43759556 TTTCTTTGATGAATCAAAATTGG - Intronic
1081524461 11:43916248-43916270 TTTCTTAAAGGAAACTGAATAGG + Intronic
1081680287 11:44997810-44997832 TTAGTGATAGGAATCAAAATGGG - Intergenic
1082041797 11:47692069-47692091 TTTCTCAAAGGGATGATAATTGG - Intronic
1082119241 11:48360234-48360256 TTTCTCAAAGAACTAAAAGTAGG + Intergenic
1082255055 11:50024913-50024935 TTTCTCAAAGAACTAAAAGTAGG - Intergenic
1082713206 11:56580088-56580110 TAGCACAAATGAATCAAAATGGG + Intergenic
1082846882 11:57733607-57733629 TTTCTCTAAGAAAAAAAAATGGG + Intronic
1082908641 11:58343690-58343712 TTTCAGAAAGGAATGAAACTAGG + Intergenic
1083517557 11:63274476-63274498 TTTGAGAAGGGAATCAAAATGGG + Intronic
1083559181 11:63658650-63658672 TTTATCAAAGAATTTAAAATGGG - Intronic
1083589289 11:63883581-63883603 TGTCTCAAAGGAAAAAAAAAAGG - Intronic
1085859895 11:80220771-80220793 TTTCTCAAAAAACTGAAAATAGG + Intergenic
1087124247 11:94607470-94607492 TTTTTTAATGGAATCATAATAGG - Exonic
1087768860 11:102185120-102185142 TTTCCAACAGGAATCAAAAGAGG - Intronic
1087844227 11:102953382-102953404 TTTCTCCAAAGAATAAAACTGGG - Intronic
1087932018 11:103988980-103989002 ATCCTCAAAGTAATCAAAAAAGG + Intronic
1088953432 11:114593618-114593640 TTTCTCAAAAAACTAAAAATAGG + Intronic
1089718989 11:120394624-120394646 TTTCTCAAAAGAACCAGATTTGG - Intronic
1091432417 12:447777-447799 TATCTCAAAGGAAAAAAAAAAGG + Intergenic
1091741888 12:2965075-2965097 TTTCTTCAAGGAAGCAAGATGGG + Intronic
1091884488 12:4006068-4006090 TCTCTCAAAGAAAACAAAACAGG - Intergenic
1092035945 12:5334501-5334523 TTTCTCAAAGAACTAAAAATAGG - Intergenic
1092960972 12:13596849-13596871 ATTCTCAAAGGAGTGATAATGGG - Intronic
1092968170 12:13665672-13665694 ATTTTAATAGGAATCAAAATGGG + Intronic
1093074040 12:14739034-14739056 TTTCTCAAAGTAATCAAAACTGG + Intergenic
1093424334 12:19011070-19011092 TTTCTCAAAAGAATATTAATTGG + Intergenic
1093494081 12:19735495-19735517 TTTCCCAAAGGAATTACAACGGG - Intergenic
1093838878 12:23871779-23871801 TTTCTAAAAGAAATCAAAACAGG + Intronic
1093888598 12:24492094-24492116 TTACTCAAACTAATCAAAAGAGG + Intergenic
1094004962 12:25739431-25739453 GTTTTCAAAGGAATGTAAATTGG + Intergenic
1094253279 12:28391954-28391976 TTTCTCAAAGATATAAAATTTGG + Intronic
1094356020 12:29578485-29578507 TTTCTCTATGGAATAAATATGGG - Intronic
1094369223 12:29718332-29718354 TTTTTCAAACTAATAAAAATAGG - Intronic
1094465064 12:30744359-30744381 TTTCCCAAAGGCATCAGAAATGG - Intronic
1094643938 12:32302824-32302846 TTACTCAAAAGAGTCAATATTGG - Intronic
1094801396 12:34039742-34039764 TTTCTGAAAGGAATGCAATTTGG + Intergenic
1095114525 12:38335744-38335766 TTTCTGAAAGGAATGCAATTTGG + Intergenic
1095421203 12:42025903-42025925 TTCCTCAAAGAAATAAAAAGTGG + Intergenic
1095622650 12:44276844-44276866 CTTCTCAAAGGAAAAAAAACAGG - Intronic
1096219322 12:49818894-49818916 TTTCTCAAAAAACTTAAAATAGG + Intronic
1097242089 12:57582496-57582518 TTTCTCTAAGGGATTAAGATGGG + Intronic
1097291517 12:57920169-57920191 TTTCTCAAAACAAACAAAAATGG + Intergenic
1097364644 12:58698453-58698475 TTCCTCAAAAGATTAAAAATAGG - Intronic
1098712969 12:73790426-73790448 TTTCTCAAACAAACAAAAATTGG - Intergenic
1099395331 12:82131621-82131643 TTTCTCAAAGAATTGGAAATAGG + Intergenic
1099908295 12:88798291-88798313 CTTCACCAAAGAATCAAAATTGG + Intergenic
1100068352 12:90679637-90679659 TTACTCGAAGGCAGCAAAATTGG + Intergenic
1100223644 12:92534160-92534182 TTTTTGAAAGGAGTAAAAATAGG + Intergenic
1101042898 12:100774818-100774840 ATTGTCCAAGGAAACAAAATCGG - Intronic
1101078628 12:101158249-101158271 TTTCTTAAAAATATCAAAATTGG + Exonic
1101185862 12:102277874-102277896 TTTCTTAAAAGAATCAAAGAAGG - Intergenic
1101359975 12:104017313-104017335 TTAGTCAAAGAAAACAAAATTGG + Intronic
1101373858 12:104154005-104154027 TGTCTCAAAAAAATCAAAAAAGG + Intergenic
1102496726 12:113324705-113324727 TGTCTCAAAGGAAAAAAAAGGGG - Intronic
1102696206 12:114801437-114801459 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1103169651 12:118805122-118805144 TTTCTCAAAGAACTTAAAAATGG - Intergenic
1103370788 12:120417607-120417629 TGTCTCAAAGGAAAAAAAAAAGG - Intergenic
1103501126 12:121403085-121403107 TTTCTCAAATGGCTCTAAATAGG + Intronic
1103714781 12:122938526-122938548 TTTCTCAAAAAAATAAAAATAGG + Intronic
1104741866 12:131183306-131183328 TTTCTCAAAGAACTAAAAGTTGG + Intergenic
1105242732 13:18622112-18622134 TTTTTCAAAGATGTCAAAATAGG + Intergenic
1105343385 13:19549597-19549619 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1105536924 13:21274487-21274509 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1106742062 13:32655074-32655096 TTTCTCAAAGAACTGAAAACAGG - Intronic
1106749879 13:32751405-32751427 TTTCTCAAAGAACTGAAAACAGG - Intronic
1106794177 13:33187286-33187308 TATCTCAAAAAAATCAAAAGTGG - Intronic
1106860140 13:33896792-33896814 TTTCTCAATGGAAACTATATAGG + Intronic
1107862718 13:44676093-44676115 TTTATTAAAAGAATTAAAATTGG + Intergenic
1108089732 13:46836545-46836567 TTTTTAAAAAGAATTAAAATTGG - Intronic
1108108773 13:47044659-47044681 CTTCTCCAAGGAATCAAAAATGG - Intergenic
1108157565 13:47601696-47601718 ATTCTCAGAGGAAGCAAGATTGG + Intergenic
1109156548 13:58917781-58917803 TATCCAAAAGGAATAAAAATAGG + Intergenic
1109387568 13:61652378-61652400 TCTGTCGAAGGAATGAAAATAGG + Intergenic
1110264920 13:73526667-73526689 TTACTCAAAGGAATGGAAATTGG + Intergenic
1111308139 13:86443705-86443727 CTTCTCTAAGGATTCAACATAGG + Intergenic
1111820772 13:93212061-93212083 CTTCTCAAAGAATTAAAAATAGG + Intergenic
1112421106 13:99249587-99249609 TTTCTCAAAGAACTTAAAACAGG - Intronic
1112518506 13:100076824-100076846 TTTCTCAAAGAATTCAACAGTGG - Intergenic
1113177674 13:107584164-107584186 TTTCTGAAATGAATGAACATAGG + Intronic
1113583256 13:111444173-111444195 TTTCTCAAAAGATTAAAAAAGGG - Intergenic
1114473167 14:22977707-22977729 TTTAGCAAAGGAATCAGAATGGG + Intronic
1115175264 14:30554867-30554889 TTTCAAAAAGCAATAAAAATGGG - Intergenic
1115692763 14:35862181-35862203 TTTCTCACAGGAATAATAATTGG - Intronic
1116129209 14:40832536-40832558 TTTCTCAAAGAACTTAAAAATGG - Intergenic
1116222102 14:42100579-42100601 TTTCTCAAAGAGTTAAAAATAGG + Intergenic
1116705519 14:48293510-48293532 TTTCTCAAAAAATTAAAAATAGG - Intergenic
1116749345 14:48863492-48863514 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1116799513 14:49428794-49428816 CTTCACAGAGGAAGCAAAATAGG + Intergenic
1116977393 14:51131400-51131422 CTTCTCAAAGGCATTAAAAGGGG + Intergenic
1117386486 14:55218969-55218991 TTTTTTAAAGGACCCAAAATAGG + Intergenic
1117506599 14:56410047-56410069 TTTGTCATAGGTTTCAAAATTGG + Intergenic
1118665703 14:68066951-68066973 ATGCTAAAAGGAAACAAAATGGG + Intronic
1120010593 14:79409070-79409092 TTTCTCAACTGAATCCAAGTAGG + Intronic
1120314850 14:82878341-82878363 TTTGTCAAAAAAATAAAAATGGG + Intergenic
1120581171 14:86251763-86251785 TTTCTCATTGGAATCACAATTGG + Intergenic
1121166723 14:91809107-91809129 TTTCTCTAAAAAATTAAAATTGG + Intronic
1202938803 14_KI270725v1_random:122194-122216 TTTCTCCAAATAATTAAAATTGG + Intergenic
1123488566 15:20762493-20762515 TTTTTCAAAGATGTCAAAATAGG - Intergenic
1123540306 15:21283146-21283168 TCTATAAAAGGACTCAAAATAGG + Intergenic
1123545062 15:21331566-21331588 TTTTTCAAAGATGTCAAAATAGG - Intergenic
1123796189 15:23773240-23773262 TTTCTCAAAGAACTGAAAACAGG - Intergenic
1124162663 15:27287490-27287512 TTCCTGAAAGAAATGAAAATTGG + Intronic
1124174463 15:27409533-27409555 TTTCAAAAAAGAATTAAAATGGG - Intronic
1125105518 15:35966839-35966861 ATTTTCCAAGGAATAAAAATAGG + Intergenic
1125625199 15:41102663-41102685 TGTCTCAAAGGAAAAAAAAAGGG + Intronic
1126959784 15:53978557-53978579 TTTCTCCCAGAAAGCAAAATGGG - Intergenic
1127106134 15:55618372-55618394 ATTTTAAAAGGAATCATAATGGG - Exonic
1127511254 15:59643896-59643918 TATCTCAAAAAAATAAAAATAGG - Intronic
1127775102 15:62258274-62258296 TTTCTCAAAGAACTCAATAAGGG + Intergenic
1128670590 15:69572124-69572146 TTTCTCAAAAGAGTCAAGTTTGG - Intergenic
1129568698 15:76654563-76654585 TTTCTCAAAGAACTTAAAACAGG + Intronic
1130156582 15:81355756-81355778 TTTCTTAAAGGAAGCTATATTGG - Exonic
1130189293 15:81716850-81716872 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1130369397 15:83271576-83271598 ATCCCCAAAGGAATAAAAATTGG + Intronic
1131546790 15:93322355-93322377 TTTCTGATAGAAATGAAAATGGG - Intergenic
1131795439 15:96011218-96011240 TTTCCCAAGGAAATCAGAATGGG + Intergenic
1202948618 15_KI270727v1_random:10294-10316 TCTATAAAAGGACTCAAAATAGG + Intergenic
1202953408 15_KI270727v1_random:58837-58859 TTTTTCAAAGATGTCAAAATAGG - Intergenic
1132894320 16:2220861-2220883 TATCTCAAAGCAAACAAAACAGG + Intergenic
1133330737 16:4971818-4971840 TTTCTCAAAGGAATGAAAGGAGG - Intronic
1133593865 16:7272185-7272207 TTTCTCAAAAAAAATAAAATAGG - Intronic
1135378136 16:21968300-21968322 TTTATAAAAGGAATAAAAAGAGG - Intronic
1135633652 16:24055927-24055949 TTTGTCAATGGAGACAAAATGGG - Intronic
1135819593 16:25671174-25671196 TTTCTTAAAGGCATCAAGAATGG - Intergenic
1135820570 16:25681775-25681797 TTTCTGAAAGGAATGTAAATTGG - Intergenic
1135912837 16:26577132-26577154 TGTTTCAAAGGAAGCAAAAAGGG - Intergenic
1136104509 16:28020144-28020166 GTTCCCAAAGAGATCAAAATCGG + Intronic
1136747095 16:32600385-32600407 TGTCTCAGAGGATTCACAATGGG + Intergenic
1137460172 16:48654086-48654108 TTTCTCAAAAAATTAAAAATAGG + Intergenic
1137938732 16:52660097-52660119 ATTCTCAAAGAACTCCAAATAGG + Intergenic
1137990431 16:53148453-53148475 TTTCTCATAGGAATGTAAAATGG - Intronic
1138820719 16:60255845-60255867 TTTATCAAAAAAATCAAATTTGG - Intergenic
1139208069 16:65048337-65048359 TTTCTCAAAGAACTGAAAATAGG + Intronic
1140154733 16:72412124-72412146 TTCTCCAAAGAAATCAAAATGGG + Intergenic
1140440441 16:74983974-74983996 TGTCTCAAATGAAGTAAAATAGG + Intronic
1140482668 16:75270425-75270447 TGTCTCAAAAAAATAAAAATAGG - Intergenic
1141306583 16:82870172-82870194 TTTCTCAAAGGAAGACAAATGGG + Intronic
1141534131 16:84667168-84667190 TTTCTCAAAGGAAACAGACAAGG - Intronic
1203049225 16_KI270728v1_random:859592-859614 TGTCTCAGAGGATTCACAATGGG + Intergenic
1143061563 17:4206320-4206342 TTACACAAAGGAATCCAAAGAGG - Exonic
1143283194 17:5770158-5770180 TTTGCCAAAGGAAAAAAAATGGG - Intergenic
1143428214 17:6857391-6857413 TTTCTCAAAGTACTTAAAACAGG - Intergenic
1144255081 17:13459570-13459592 TTTCTGGAAGAAATCATAATGGG - Intergenic
1144722808 17:17483973-17483995 TTTCTTATAGGCATGAAAATGGG - Intronic
1145113863 17:20189919-20189941 TTTAACAAAGGAAGTAAAATGGG + Intronic
1147015953 17:37491237-37491259 TTTCTCAAGGGAACCAAGACTGG - Intronic
1147041172 17:37720207-37720229 TTGCTCAAAGGAAACAAAAGAGG + Intronic
1147436327 17:40418461-40418483 TTTTTCAAAGAAATAAAAGTAGG + Intergenic
1147641708 17:42006317-42006339 TTTCTCAAAAAAAAAAAAATTGG - Intronic
1147724417 17:42557684-42557706 TGTCTCAAAAAAATAAAAATTGG + Intergenic
1147868705 17:43572011-43572033 TGTCTCAAAAAAATAAAAATAGG - Intronic
1148981836 17:51583495-51583517 TTCCTCAAAAAAATTAAAATAGG - Intergenic
1149052101 17:52317841-52317863 TTACTTAAAGGTATCAATATAGG - Intergenic
1149243580 17:54679231-54679253 TGTCTCAAAGGAAAAAAAAAAGG + Intergenic
1149331934 17:55591986-55592008 TTTCTCAAAGAACTAAAAATAGG - Intergenic
1150077880 17:62208721-62208743 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1151105449 17:71611111-71611133 TTTCTCAAAGTATTAAAAATTGG - Intergenic
1151262769 17:72929647-72929669 TTTCTTAAAGGGAGAAAAATAGG + Intronic
1153364189 18:4235630-4235652 TTTCTCAAAACACTGAAAATGGG - Intronic
1153441986 18:5130971-5130993 TTTCTCAAAGAATTAAAAACAGG + Intergenic
1153922227 18:9802202-9802224 TTTATCAAAAGAATCCAACTGGG + Intronic
1154281830 18:13010241-13010263 TTTATCAAAGAAATCAAAGCTGG + Intronic
1154446206 18:14437765-14437787 TTTTTCAAAGATGTCAAAATAGG - Intergenic
1155812812 18:30259821-30259843 TAACTCAAATGAATCTAAATAGG + Intergenic
1156160034 18:34348593-34348615 TCTCTCAGAGTAATGAAAATAGG - Intergenic
1157216244 18:45786071-45786093 CTTCTCAATGGAAGCAAATTTGG + Intergenic
1157657405 18:49404466-49404488 TTTCTCAAAGAACTTAAAACAGG - Intronic
1157875752 18:51271955-51271977 TTTCTCAAAAAACTAAAAATTGG + Intergenic
1158696525 18:59708868-59708890 AGGCTCAAAGGAATCAAAAGAGG - Intergenic
1159048065 18:63389020-63389042 ATACTCAAAGGAATCCGAATGGG - Intergenic
1159267087 18:66095851-66095873 TTTCTCAAAAGCATCAAACATGG + Intergenic
1159504844 18:69322663-69322685 TTTCTCATAGGAATATAAAAAGG + Intergenic
1162884727 19:13688172-13688194 TGTCTCAAAGGACTCATATTCGG - Intergenic
1165272085 19:34718727-34718749 TTTCTCAAAAAATTAAAAATAGG + Intergenic
1165440514 19:35823998-35824020 TGTCTCAAAAAAATAAAAATAGG + Intergenic
1166355505 19:42225056-42225078 TTTCTCTAGGGAGTCAAAGTGGG - Exonic
1166388794 19:42397337-42397359 TTTCTCCAAGAAAGCAAGATGGG - Intergenic
1166889575 19:45982261-45982283 TATCTAAAAGAAATAAAAATGGG + Intergenic
1202634068 1_KI270706v1_random:28022-28044 TGTCTCAAAAAAATAAAAATTGG + Intergenic
925024336 2:595812-595834 TTTTTCAAAGACGTCAAAATAGG + Intergenic
926163847 2:10505779-10505801 TTTTTAAAAGGAAGAAAAATGGG + Intergenic
926380767 2:12287027-12287049 ATGCTCCAAGAAATCAAAATTGG + Intergenic
926509173 2:13752039-13752061 TTCCTTTAAGGAATCAAACTTGG + Intergenic
926769905 2:16361635-16361657 CTTCTCAAAGGAAACACTATTGG + Intergenic
926949374 2:18225474-18225496 TTTCTCAAAGAACTTAAAACAGG - Intronic
927916092 2:26937496-26937518 TTTCTTATAGGAATAATAATTGG - Intronic
928464011 2:31503210-31503232 TTTCTCACAGTAGTCAAAAATGG + Intergenic
928722533 2:34136819-34136841 TTGCTCAAAAGAATTGAAATAGG - Intergenic
929065319 2:37967371-37967393 TTTCTTTAAGGAATCATAACAGG + Intronic
929259611 2:39850812-39850834 TTGCTCAAAAGAATGTAAATTGG + Intergenic
929813750 2:45214082-45214104 TCACTCAAAGAAATAAAAATAGG + Intergenic
930224959 2:48783099-48783121 TGTCTCAAAGAAAAAAAAATGGG - Intergenic
930689003 2:54339901-54339923 TTTCTCAAAGAATGGAAAATAGG + Intronic
931076689 2:58723114-58723136 TTTCTTAAAGGAATCAGATATGG - Intergenic
931195031 2:60043873-60043895 GTTCTCAAAGAAAACAAAAAGGG - Intergenic
931940288 2:67244604-67244626 ATCCAGAAAGGAATCAAAATGGG - Intergenic
932069418 2:68602662-68602684 TTTTTAAAAAGCATCAAAATTGG + Intronic
932165492 2:69502298-69502320 AATCTCAAAGAAATAAAAATGGG + Intronic
933192481 2:79350683-79350705 TTTCTCAAAGGACTAAAACTAGG - Intronic
933297193 2:80504134-80504156 CTTCTCAAAGGAATAAAAACTGG - Intronic
933588180 2:84202292-84202314 GTTCTCAAAGGAGGCAAAAGGGG + Intergenic
935536301 2:104298571-104298593 TTTCTCAAAAGAAAAAAAAAAGG - Intergenic
935885977 2:107620035-107620057 TTCCTTTAAGGAATCAAACTTGG + Intergenic
935979419 2:108612302-108612324 GTTCTCAGAGGAACCGAAATCGG + Intronic
936471346 2:112801504-112801526 TTTTTAAAAGGAAGCAACATAGG - Intergenic
937613885 2:123896751-123896773 TTTATTAAAGGAAATAAAATAGG - Intergenic
937817343 2:126266227-126266249 TTCCTCAAAGAATTAAAAATAGG - Intergenic
937824487 2:126352416-126352438 TTTCTCAAAGAACTAAATATAGG + Intergenic
938166122 2:129028488-129028510 TTTCTCACAGGAACCTTAATAGG + Intergenic
938940253 2:136163545-136163567 TTTCACAGAGGAATCAAAAAAGG - Intergenic
939344491 2:140946296-140946318 TTTTTCAAAGGAGTAAAAACAGG + Intronic
940115646 2:150205321-150205343 TGTCCCAAAGGATTCAAAACAGG + Intergenic
940176480 2:150882876-150882898 TGTCTCATAGGAATCATACTTGG + Intergenic
940382824 2:153035598-153035620 TTTCTCAAAAAACTAAAAATGGG + Intergenic
940449899 2:153824319-153824341 TTTCTCAAAGAACTTAAAAGAGG + Intergenic
940603315 2:155888266-155888288 TTTCTCAAAACACTAAAAATAGG + Intergenic
940717188 2:157239343-157239365 TTCCTCAAAGTAACCAATATGGG - Intergenic
941172050 2:162150224-162150246 CTTCTCAAAGGAAACACCATTGG - Intronic
941584067 2:167335177-167335199 TTTCTCAAAAGAAAAAAAAACGG + Intergenic
941824715 2:169881519-169881541 TTTTCCAAAGGGATAAAAATAGG + Intronic
941886154 2:170529709-170529731 TTTCTCAAACTTTTCAAAATAGG - Intronic
942388333 2:175465048-175465070 GTTCTCAAGGGAATGAATATGGG - Intergenic
942823390 2:180143541-180143563 TTTCCCAGAGCAATCAACATTGG + Intergenic
942889831 2:180976657-180976679 TTTCTAGTAGGAATGAAAATTGG - Intronic
943063570 2:183063655-183063677 TTTCCCAAAGCACTCAATATTGG + Intergenic
943520731 2:188945401-188945423 TTACTAAAAAGACTCAAAATAGG + Intergenic
943522358 2:188968671-188968693 TTTCTTAAAAAAATCAATATAGG - Intergenic
944549845 2:200835539-200835561 TGTCTCAAAAGAAAAAAAATGGG + Intergenic
944579748 2:201121881-201121903 TTGATCAAAGGAATAAAAAGTGG - Intronic
945085609 2:206129222-206129244 TTTCTTAAAGGACTAAAAACAGG + Intronic
945112059 2:206369293-206369315 CTTCTTAAAGGAATCAAATTGGG + Intergenic
945129204 2:206549536-206549558 TTTCTCAAAGGAAAAAATATTGG - Intronic
946852953 2:223925064-223925086 TTTATCCAAGGAGTAAAAATGGG + Intronic
947021021 2:225675690-225675712 TTTCTCAAAGAACTTATAATAGG - Intergenic
947139973 2:227011680-227011702 TTTCTTAAAAGAAAAAAAATGGG - Intronic
947631575 2:231656869-231656891 TTTCTCAAAGAAAAAAAAATGGG + Intergenic
947704730 2:232265042-232265064 TTTCTTAAAGGAAGGAAAGTAGG - Intronic
948401265 2:237687302-237687324 TTAGTCAAAGGGATCCAAATAGG + Intronic
1169625148 20:7558649-7558671 TTTCTCAAAAGACTTAAAAATGG - Intergenic
1169629607 20:7614943-7614965 TTTCTCAAATGAATTACATTTGG - Intergenic
1169785141 20:9351646-9351668 CTACTAAAAGGAATCTAAATCGG - Intronic
1169808704 20:9586272-9586294 TATCTCAAAGGAATCACACAGGG - Intronic
1170170825 20:13410376-13410398 TTTCTCAAAAAACTGAAAATAGG - Intronic
1170180674 20:13526348-13526370 TGTCTCAAAGAAATCACAGTTGG - Intronic
1170264731 20:14452725-14452747 TTTACCAAAGGATTCACAATAGG - Intronic
1170825793 20:19794066-19794088 TCTCTTAAAGGAAGTAAAATTGG - Intergenic
1170981814 20:21221327-21221349 TTTGTCAAATGAATAAAAATGGG + Intronic
1171152522 20:22839737-22839759 TTAATTAAAGGAATTAAAATGGG + Intergenic
1172463216 20:35135736-35135758 TTTTTAAAGGGAAGCAAAATAGG + Intronic
1174032355 20:47640030-47640052 TTTCTCATGGCACTCAAAATAGG + Exonic
1174821219 20:53728001-53728023 TTTCTCACTTGAAACAAAATTGG - Intergenic
1174969069 20:55253545-55253567 CTTCTCTGAGCAATCAAAATAGG + Intergenic
1175173421 20:57094945-57094967 TTGCTCATGGTAATCAAAATGGG + Intergenic
1175212769 20:57371707-57371729 TGATTCAAAAGAATCAAAATGGG + Intronic
1176449776 21:6852081-6852103 TTTTTCAAAGATGTCAAAATAGG + Intergenic
1176827948 21:13717105-13717127 TTTTTCAAAGATGTCAAAATAGG + Intergenic
1176930079 21:14799289-14799311 TTCCTCAAAATAATAAAAATAGG - Intergenic
1177198964 21:17932400-17932422 TTTCTCAAAGAACTGAAAGTAGG + Intronic
1177423046 21:20886598-20886620 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1177457268 21:21356117-21356139 TTTCTCTCAGGAATAAAGATAGG + Intronic
1178294464 21:31397427-31397449 TTTTTCAAAGGAATTAAAATGGG - Intronic
1178613896 21:34113180-34113202 TTTCTCAAAATATTAAAAATAGG + Intronic
1178928481 21:36795393-36795415 TTTCTTAATATAATCAAAATGGG + Intronic
1179042793 21:37818846-37818868 TTTCTGACAGGAAGCAAAACAGG + Intronic
1182306493 22:29372896-29372918 TTTCTCCAATGTCTCAAAATTGG + Intronic
1182562916 22:31175536-31175558 TTTCTCATAGGAATATAAATTGG + Intronic
1183049522 22:35249540-35249562 CTTCTCAGAGGAATAGAAATTGG - Intergenic
1183269486 22:36851722-36851744 TTTCCTAAAGGCATCAAAAGGGG - Intergenic
1183768497 22:39901804-39901826 TTTCGTAAAGGAATGAAAACTGG - Intronic
949368985 3:3314192-3314214 TTTCTCAAAAAATTTAAAATTGG - Intergenic
950357035 3:12420293-12420315 TTACTCTAAGGAAGCACAATCGG - Intronic
951107822 3:18766022-18766044 TTTCTAACAGGAATACAAATTGG - Intergenic
951732494 3:25825803-25825825 TTTCTCAAAGGACTTAAAATGGG + Intergenic
952026062 3:29083887-29083909 CTTGGCAAAGGAATCAAAGTTGG - Intergenic
952228703 3:31406404-31406426 TTTCTAAAAAGAATTGAAATGGG + Intergenic
953630784 3:44614833-44614855 TTTCTCAAAAAATTAAAAATAGG + Intronic
954281841 3:49585648-49585670 TTTCTCAAAAAACTAAAAATTGG - Intronic
954522747 3:51243499-51243521 TTTCTCAAAGGAAGATAATTAGG - Intronic
955312975 3:57908601-57908623 ATTCTCAAAGAAATTAGAATTGG + Intronic
955648351 3:61165186-61165208 TTTCTCAAAGAACTTAAAACAGG - Intronic
955677176 3:61460969-61460991 TTTCTTAAAGTAATCACAACTGG - Intergenic
955780640 3:62480669-62480691 ATTATCAAAGGAATAAAAAATGG - Intronic
956513659 3:70022244-70022266 TTTCTTAATGAAATCAAATTAGG - Intergenic
957106940 3:75901912-75901934 TTTGTTAAAGGAATAAACATAGG - Intergenic
957486511 3:80869665-80869687 TTTATAAAAGGCATCCAAATAGG + Intergenic
958596824 3:96236690-96236712 CTTCTGAAAGGAATATAAATCGG - Intergenic
958776670 3:98492409-98492431 TTTCTCAAAGGAATGAATAATGG + Intergenic
959237383 3:103741856-103741878 ATTCTGAAAGTAATAAAAATTGG + Intergenic
959293607 3:104506161-104506183 TTTCTCAAAAAACTAAAAATAGG - Intergenic
959449726 3:106484019-106484041 TTTTTCAAAGAACTTAAAATAGG + Intergenic
959541789 3:107548584-107548606 TTTCTCAAAGAACTTAAAATAGG + Intronic
960013797 3:112862466-112862488 TTTCTCAAAAAACTAAAAATAGG - Intergenic
960115900 3:113892121-113892143 TTTTTCAAAGGAAACATATTTGG - Intronic
960150336 3:114242724-114242746 GTTATAAAAGGAATCAAATTAGG - Intergenic
960232461 3:115244288-115244310 TTTCTCAAAGAACTAAGAATAGG + Intergenic
960391894 3:117087464-117087486 TTTCTCAAAGGCTCAAAAATTGG + Intronic
962007844 3:131365360-131365382 TTTCTCAAAGAAAGGCAAATAGG - Intergenic
963030891 3:140974913-140974935 TTTCTAAAAGAAGTCAAAATAGG + Intronic
963485115 3:145925855-145925877 TTTCTGTAAGACATCAAAATAGG - Intergenic
963730800 3:148969997-148970019 ATTTTCAAAGGGATCAAATTTGG - Intergenic
964168064 3:153733514-153733536 TATCTCTAAGGAAACAAAGTGGG + Intergenic
964596099 3:158430659-158430681 ATTCTCAAAGGACTCACAGTGGG + Intronic
964678306 3:159308607-159308629 TTTCTCAAAGAACTTAAAACAGG + Intronic
964732129 3:159878476-159878498 TGTCTCAAAAAAATAAAAATAGG + Intronic
965141713 3:164845845-164845867 TTCCTGAAAGGAAACAGAATAGG + Intergenic
965601173 3:170456072-170456094 TTTCTCAAAGAACTTAAAACAGG - Intronic
965604996 3:170489533-170489555 TTTCTCAAACAACTGAAAATTGG + Intronic
965715169 3:171595022-171595044 TCTCTCAAAGGAATTTAAACTGG + Intergenic
965888663 3:173481605-173481627 ATTTTCAAAGTAAACAAAATAGG - Intronic
966065800 3:175820036-175820058 ATTTTCAAAGTAAACAAAATAGG - Intergenic
966469725 3:180275512-180275534 TTTCTGAAAGCAATCTAATTTGG - Intergenic
966590417 3:181676090-181676112 TATCACAAAGGAATTAAAAATGG - Intergenic
966633765 3:182108893-182108915 TTTCTTAAAAGCATCAAGATAGG - Intergenic
967451646 3:189630648-189630670 TTTCTTAAAGATATTAAAATTGG - Intergenic
967660788 3:192106940-192106962 ATTCACATAGGAATCATAATAGG + Intergenic
967896514 3:194400331-194400353 TTTCTCAAATGAAGCACAAGTGG - Intergenic
968311350 3:197686248-197686270 TCTCTCAAAGGAAAAAAAAAAGG - Intronic
969902777 4:10364965-10364987 TTTCCCAAAGGCATCACAAGAGG - Intergenic
970117891 4:12719749-12719771 TTTTTCAAAGGAATCTAGTTGGG - Intergenic
970623817 4:17855308-17855330 TTTATAAAAAGAATAAAAATAGG + Intronic
970875796 4:20868433-20868455 TTTCTCAAAGAACTTAAAACAGG + Intronic
971966616 4:33566523-33566545 TTCCAAAAAGGATTCAAAATCGG - Intergenic
973245444 4:48005758-48005780 TTGCTTTAAGGAATCAAACTTGG - Intronic
974467485 4:62275555-62275577 TTTTTCAAAGGAAGGAAAAATGG + Intergenic
974683209 4:65191729-65191751 TTTCTCAAAGAACTTAAAACAGG - Intergenic
974764517 4:66325097-66325119 ATTTTCAAAGAAAGCAAAATAGG + Intergenic
974766763 4:66357403-66357425 TTTCTCAAAGAAGTTAAAATAGG - Intergenic
975070115 4:70124578-70124600 TTCCTCAAAGAATTAAAAATAGG + Intergenic
975225994 4:71872540-71872562 TTTCCCAAAGGAATGAAGAGTGG - Intergenic
975408944 4:74025376-74025398 TTTTTGAAATGAATGAAAATTGG - Intergenic
976138581 4:81965430-81965452 TTTCTCAAAAAACTAAAAATAGG - Intronic
976579483 4:86718912-86718934 TTGTTCAAAAGTATCAAAATGGG - Intronic
977388204 4:96372029-96372051 ATTCTCAAGTGAATGAAAATAGG + Intergenic
977517694 4:98042521-98042543 TTTTTGAAATGAATAAAAATGGG - Intronic
978394434 4:108263485-108263507 ATTTTCAAAGCAAACAAAATAGG + Intergenic
978541142 4:109817234-109817256 GATTTCAAAGGAAACAAAATCGG + Intronic
979282843 4:118886772-118886794 TTTCTGAAAAGAATCAAACTTGG + Intronic
979429744 4:120614695-120614717 TTCCTCAGAGGAAACAAAAATGG + Intergenic
979873252 4:125852758-125852780 TTCCTCAAAGAAACCAGAATTGG + Intergenic
979933069 4:126656517-126656539 TTTCTCAAAGAACTGATAATAGG - Intergenic
980079505 4:128329045-128329067 TTTCTCAAAAAATTAAAAATAGG + Intergenic
980252005 4:130329099-130329121 TTTGTCAAAGAATTCAATATTGG + Intergenic
980319786 4:131256345-131256367 TTTCTCACAGAAATCATAAGGGG - Intergenic
981460083 4:145003426-145003448 TTTCTCAAAGAGATTAAAAATGG - Intronic
981519187 4:145643558-145643580 TTTCTCAATGGGATGATAATAGG - Intronic
981864920 4:149406098-149406120 TTTCTTCAAGGAAGCAAACTTGG - Intergenic
981918716 4:150063296-150063318 TTTCTAAAAATAAACAAAATAGG - Intergenic
982475803 4:155849123-155849145 TTCCTTTAAGGAATCAAACTTGG + Intronic
982551783 4:156810909-156810931 TTTCTAAAGGAAATCAAATTAGG - Exonic
982713509 4:158782566-158782588 TTTGTGAAATGAATCAAAAGAGG - Intronic
982796638 4:159654072-159654094 TTTCACAAAGCAAGCAATATTGG + Intergenic
984017954 4:174448276-174448298 TTTTTCAAAGGATTCAATCTTGG - Intergenic
984191486 4:176611514-176611536 TATCTCAAAGGAATCAGATGTGG - Intergenic
984693905 4:182759894-182759916 CTTCTCTAATGAATCACAATAGG - Intronic
986415922 5:7528099-7528121 TCTTTCAAAGGCATTAAAATTGG + Intronic
986648456 5:9941041-9941063 TTTCTCAAAGGAAGACAAAAGGG + Intergenic
986755198 5:10829297-10829319 TTTCTCAAAGAACTAAAAGTTGG - Intergenic
986910248 5:12547046-12547068 TTTAAAAAAGGAATCAAAAAAGG + Intergenic
987626129 5:20403168-20403190 TTTCTTAAAGGCATCAAGAATGG + Intronic
987692251 5:21282315-21282337 TTTTTCAAAGCAATTAAATTGGG - Intergenic
988138781 5:27208887-27208909 TTTGTCAATGGAATTAAAAGAGG + Intergenic
988992264 5:36683090-36683112 GTTGTCAAAAGAATCAAATTTGG - Intronic
989184372 5:38609166-38609188 TTAGTCAAAGGTATTAAAATAGG - Intergenic
989249097 5:39287388-39287410 TTTCTCAAAAAATTAAAAATAGG + Intronic
989518193 5:42368521-42368543 TTGCTAAAGGGAATAAAAATTGG + Intergenic
989965502 5:50461804-50461826 TTTATCAATGGAGGCAAAATTGG + Intergenic
990053761 5:51543645-51543667 GTCATCAAAGGAAACAAAATAGG - Intergenic
990093167 5:52081126-52081148 TTGATCAAATTAATCAAAATTGG + Intergenic
990361128 5:55020973-55020995 TTTTTCAAAGGAATGTAAAAGGG + Intronic
990689160 5:58343388-58343410 TTTCTCAGAGAAATAGAAATGGG + Intergenic
991013423 5:61907749-61907771 TTTCTCAAAGAACTAAAAATAGG + Intergenic
991112610 5:62918169-62918191 CTTCTCAAAGGAAAAAAACTGGG - Intergenic
991748109 5:69767742-69767764 TTTTTCAAAGCAATTAAACTGGG + Intergenic
991799689 5:70347589-70347611 TTTTTCAAAGCAATTAAACTGGG + Intergenic
991828908 5:70662449-70662471 TTTTTCAAAGCAATTAAACTGGG - Intergenic
991892047 5:71347018-71347040 TTTTTCAAAGCAATTAAACTGGG + Intergenic
992554965 5:77893978-77894000 TGATTCAAAGGAATAAAAATGGG + Intergenic
992566659 5:78002133-78002155 TTACTCCAAGGAAAAAAAATTGG - Exonic
993423361 5:87730476-87730498 TTTCTGAAAGGCTTCAAAATTGG - Intergenic
993489560 5:88530095-88530117 TTTCTCAAAGGAATGTAGAATGG - Intergenic
993748250 5:91629839-91629861 TATCTCAAAAGAATAAAAACTGG + Intergenic
994382834 5:99091621-99091643 TTTCCCACAGGAATCTATATTGG + Intergenic
994508080 5:100666672-100666694 TTTGTCAAATGAATTACAATTGG - Intergenic
994781084 5:104090834-104090856 TTATTTAAAGGAATGAAAATAGG - Intergenic
995596778 5:113755882-113755904 TTTTTCAAAGGAAGGAAAATGGG + Intergenic
995929225 5:117416285-117416307 TTTCTTTTAGGAATCAAAAAAGG - Intergenic
996190357 5:120533203-120533225 TATCTTCAAGGAATCAAATTTGG + Intronic
996652981 5:125904096-125904118 TTTATAAAAGAAATGAAAATGGG + Intergenic
997140316 5:131372830-131372852 TGTCTCATAGGATTCAAGATAGG + Intronic
997603348 5:135155516-135155538 TTTCACAGAGGTTTCAAAATGGG + Intronic
998273662 5:140730895-140730917 TTTATGAAAGTAATCAAAATAGG - Intergenic
998568545 5:143237192-143237214 TTGCTCAAAGCAATCTGAATTGG + Intergenic
998577792 5:143335431-143335453 TTTGTCAAATGAAGCTAAATTGG + Intronic
998707750 5:144783193-144783215 TTTCACAAAGGGGTGAAAATTGG + Intergenic
999760195 5:154693927-154693949 TTTTTCACAGGAGCCAAAATAGG - Intergenic
999834872 5:155358986-155359008 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1000213653 5:159133918-159133940 TTTCTCAAAGAACTAAAAATAGG - Intergenic
1001938537 5:175724720-175724742 TTCCTCAAAGAACTAAAAATAGG - Intergenic
1001987217 5:176084945-176084967 TGTCTCAGAGGACTCACAATGGG + Intronic
1002035324 5:176464252-176464274 TTTATCCAAGCAATTAAAATAGG - Intronic
1002229651 5:177753202-177753224 TGTCTCAGAGGACTCACAATGGG - Intronic
1002265694 5:178030575-178030597 TGTCTCAGAGGACTCACAATGGG + Intronic
1002773887 6:312259-312281 ATTCTGAAAGGAATGAAAATGGG - Intronic
1002953638 6:1840735-1840757 TTTCTCAAAGGAGCCAAAACTGG + Intronic
1003497782 6:6679271-6679293 TTTGTTAAAGGAATCAATTTAGG - Intergenic
1004311027 6:14544990-14545012 ATTCTCAAGGGAATCAGATTGGG + Intergenic
1004318319 6:14611577-14611599 TTTCACAAAGAAAACAAATTGGG - Intergenic
1004464836 6:15875150-15875172 TTTCTCAAAGAACTAAACATAGG + Intergenic
1004828210 6:19447192-19447214 CTGCTCAAAGGAATCAGAAATGG + Intergenic
1005577316 6:27202000-27202022 TGTCTCAAAAAAATAAAAATAGG - Intergenic
1006576892 6:35053173-35053195 TTTTCCAAAGGAATGAAAAGAGG - Intronic
1006587239 6:35123789-35123811 TGTCTCAAAAGAATCCAAAAAGG - Intronic
1007258712 6:40546935-40546957 TTTGTCAAATGAGACAAAATAGG + Intronic
1007604084 6:43103873-43103895 GCTCTCAAATGGATCAAAATAGG + Intronic
1008036864 6:46754253-46754275 TTTCTAAAAGGCATCCAAACTGG + Intronic
1009299798 6:62002078-62002100 TTACTCAAGGTAATCAAAAAAGG - Intronic
1009584318 6:65578021-65578043 TTTCTCAAAAAATTGAAAATAGG + Intronic
1009985504 6:70777401-70777423 TTTCTCAAAAGACACAAAAATGG - Intronic
1009993378 6:70871441-70871463 TGTCTCAAAAAAATCTAAATAGG - Intronic
1010165613 6:72911645-72911667 TTTCTCAACAGCATCATAATTGG - Intronic
1010750186 6:79608810-79608832 TATATCTAATGAATCAAAATTGG - Intergenic
1011061449 6:83274498-83274520 TTTTTCAAAGGATTCATAAAAGG + Intronic
1011508157 6:88070879-88070901 CTTCTCAATGGAAACAAAATAGG - Intergenic
1011533444 6:88350739-88350761 TTTCTCAAAGAAAAAAATATAGG + Intergenic
1012398589 6:98826162-98826184 TTCCTCGACTGAATCAAAATAGG - Intergenic
1012622297 6:101360564-101360586 TTTCTAAAAGAAATAAAAAATGG + Intergenic
1012633205 6:101499567-101499589 TCTCCAAAAGGAAACAAAATAGG - Intronic
1012636582 6:101550347-101550369 TTTCTCAAAGGAAAGAGAACAGG - Intronic
1012909675 6:105104732-105104754 TCTCTCAAAGGAATATCAATAGG + Intronic
1012978856 6:105809076-105809098 TTTCTCAAAGTAAACAGAGTTGG - Intergenic
1013092405 6:106912088-106912110 TTTAACAATGGAACCAAAATGGG - Intergenic
1013453892 6:110312295-110312317 TTTCTCAAAAGACTAAAAATAGG + Intronic
1013471104 6:110466719-110466741 TTTCTCAAAGAACTAAAAATAGG + Intronic
1014506009 6:122257525-122257547 TTTCCCACAGAAATCAAACTTGG + Intergenic
1015017685 6:128434069-128434091 TGTCTAAATGGAATCAAGATGGG - Intronic
1015073216 6:129122990-129123012 TTCCTCAAAAAATTCAAAATGGG + Intronic
1015130264 6:129801825-129801847 TTTCTCAAAAGAATCTGAATAGG + Intergenic
1015248035 6:131097142-131097164 TTTCTCAAAGGCCTAAAAACAGG + Intergenic
1015914866 6:138205533-138205555 TTGCATAAAGGAAACAAAATTGG + Intronic
1016200496 6:141401595-141401617 TTTTTTAAAGGAAACAAAAGAGG - Intergenic
1016249966 6:142028943-142028965 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1016663301 6:146605970-146605992 TTTCTCAAAGAACTTAAAACAGG - Intronic
1016720607 6:147292581-147292603 TATGGCAAAGGAATTAAAATAGG + Intronic
1016907137 6:149162318-149162340 TATCTCAACGAAATAAAAATGGG - Intergenic
1017173087 6:151476204-151476226 TTTCTAAAAGGTTTAAAAATGGG - Intergenic
1017528347 6:155262788-155262810 TATCTCAAAGGAATGAAATCAGG - Intronic
1018553506 6:165026111-165026133 TTTCTCAAAGGGATCATACATGG - Intergenic
1018700528 6:166422576-166422598 TTTCTCAAAGGCAAGAAATTGGG + Intronic
1020377962 7:7509132-7509154 TGTCTCAAAAAAAACAAAATAGG - Intronic
1020573815 7:9900320-9900342 TTTCTCAAAGAACTAAAAATAGG + Intergenic
1020737429 7:11968532-11968554 TGTCTCAAAGGAAAAAAAAAAGG + Intergenic
1020783001 7:12539099-12539121 TTTCTCACAGAAATCAGAAATGG + Intergenic
1021126578 7:16857629-16857651 TTTATCTAAAAAATCAAAATAGG + Intergenic
1021354229 7:19634360-19634382 TTTCTCAAAAAACTAAAAATAGG + Intergenic
1021490783 7:21218404-21218426 TGTGTGAAAGGAATCTAAATTGG - Intergenic
1021760149 7:23895725-23895747 TTTCTCAGATGAATCAGCATTGG - Intergenic
1021852900 7:24826028-24826050 TTTCCCAAAGGTATGAAAAAAGG + Intronic
1022171107 7:27832577-27832599 TATATCAAAGTAATGAAAATGGG + Exonic
1022348425 7:29540643-29540665 TTTCTCAAAGGAATTATAACAGG + Intergenic
1022760834 7:33348845-33348867 TTACTCAAAAGAATAAAGATTGG - Intronic
1024120191 7:46228949-46228971 TTTCTCAAAATAATTAATATAGG + Intergenic
1024340350 7:48251246-48251268 TTTCTGAAAAGAGTCAAAAGTGG - Intronic
1024584741 7:50832353-50832375 TTTCTCCCAGGAATCCACATTGG - Intergenic
1024602586 7:50996951-50996973 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1024821950 7:53342275-53342297 TTCCTTTAAGGAATCAAACTTGG + Intergenic
1026333097 7:69370311-69370333 AAACTCAAAGGAAACAAAATGGG - Intergenic
1027603306 7:80267344-80267366 TTTATAAATGGAAACAAAATAGG + Intergenic
1027638950 7:80710250-80710272 TTTTTCAAAGGAGACAAAAATGG + Intergenic
1027837901 7:83269365-83269387 TTTTTCAAAGGTAGCAATATGGG - Intergenic
1027846166 7:83378841-83378863 TTTCTCAAAGAACTAAAAATAGG + Intronic
1028010773 7:85640869-85640891 TTTCACAAAGGAATCAAGCCAGG + Intergenic
1028367223 7:90048062-90048084 TTTCTCAAAAAACTAAAAATTGG + Intergenic
1028431714 7:90755057-90755079 TTTCTCAAAGAACTTAAAACAGG + Intronic
1028547896 7:92025141-92025163 TTTCTGATATGAAACAAAATAGG + Intronic
1028761475 7:94501990-94502012 TTTCTCAAAGAACTAAAAATAGG + Intergenic
1028806404 7:95031371-95031393 TTTATGAAAGGATTCCAAATAGG - Intronic
1028959279 7:96731165-96731187 TATATTAAAGAAATCAAAATAGG + Intergenic
1029571478 7:101372546-101372568 CTTCTCAGAGGAGTCAACATAGG + Intronic
1029606922 7:101604874-101604896 TGTCTCTAAGGAATAAAAAAGGG - Intergenic
1030433312 7:109481396-109481418 TGTTTAAAAGGAAACAAAATAGG - Intergenic
1030916912 7:115326359-115326381 TATCACAAAGGAAAAAAAATAGG + Intergenic
1030944406 7:115698934-115698956 TTACTTTAAGGAATCAAAAGAGG + Intergenic
1031129467 7:117815249-117815271 TTTCACCATGGAATCAAAATGGG - Intronic
1031282904 7:119827308-119827330 TTTCTCAAAGAACTTAAAATAGG - Intergenic
1031352416 7:120751108-120751130 TTGCTCAAAAGAATAAAAAAGGG + Intergenic
1031472242 7:122180889-122180911 TTTCTCAAAAAACTAAAAATAGG - Intergenic
1031728898 7:125272834-125272856 TTTCTCAAAGAACTAAAAAGAGG - Intergenic
1031828459 7:126596203-126596225 TTTCTCAAAGAACTTAAAACAGG - Intronic
1032836042 7:135674863-135674885 CTTCTCAAAAGAATCATACTTGG + Exonic
1033194580 7:139316844-139316866 GTTCACAAAAGAATAAAAATTGG - Intergenic
1033796170 7:144848028-144848050 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1034049007 7:147961849-147961871 TTTATTAAAGGAATTAAATTAGG + Intronic
1036640705 8:10581738-10581760 TTTGTTAAAGGATACAAAATAGG + Intergenic
1036917238 8:12815771-12815793 TTTCTCAGAGGAAGCAATGTGGG + Intergenic
1037058535 8:14476988-14477010 TTTCCCAATGGGAACAAAATAGG - Intronic
1037199957 8:16240219-16240241 TTTCTCAACTGACTCAAAATTGG + Intronic
1037230694 8:16654590-16654612 TTTCTCTAAGAAATTAAAGTGGG + Intergenic
1037377407 8:18245980-18246002 TTTCTTAAAAGAAACAAAAATGG + Intergenic
1037383006 8:18308334-18308356 TTTCTCAAAAAATTAAAAATAGG + Intergenic
1037799080 8:22022289-22022311 TTTCTCAAAAAACTAAAAATAGG - Intergenic
1038136240 8:24789407-24789429 TTTCTCAAAAAACTAAAAATAGG - Intergenic
1038464453 8:27748366-27748388 TTTCTAAAGGGAATTAAACTGGG - Intronic
1039192542 8:34993465-34993487 TTTTTCAAACTAATCAGAATTGG + Intergenic
1039374664 8:37021189-37021211 TTTCCCTTAGGAATTAAAATGGG + Intergenic
1039496936 8:37987324-37987346 TTTCCCAATGGAATGATAATGGG - Intergenic
1039745955 8:40427227-40427249 TTACTCAGAGGAATGTAAATAGG + Intergenic
1039857578 8:41429486-41429508 TATCTCAAAAAAATAAAAATTGG + Intergenic
1040026773 8:42788645-42788667 TTTCTCAAGGAACTAAAAATAGG + Intronic
1040560150 8:48516665-48516687 CTTTTCAAATGAATCAAAAATGG - Intergenic
1040722487 8:50343007-50343029 TTACTCCCAGGAAACAAAATTGG + Intronic
1040926563 8:52689926-52689948 TTTCTCAAAAGAAAAAAAAAAGG + Intronic
1040956023 8:52980703-52980725 TGTCTCAATGGTATCCAAATTGG + Intergenic
1041745029 8:61199114-61199136 TTTCTCAAAGAACTAAAAATAGG - Intronic
1041834992 8:62201639-62201661 GTTCTCAAAGGAGCCAAAATGGG + Intergenic
1042237504 8:66627617-66627639 TTTAGCAAAGGAATAAAATTTGG - Intergenic
1042408230 8:68430882-68430904 TTCCTTATAGGAAACAAAATAGG + Intronic
1042566003 8:70112745-70112767 TTTAAAAAAGGAATGAAAATAGG + Exonic
1043125054 8:76382771-76382793 TGTCTCAATGAAATAAAAATCGG - Intergenic
1043736344 8:83750156-83750178 TTTCTCAAAGAAATAAAAATAGG - Intergenic
1044241634 8:89894346-89894368 TTTCAAAAAGAATTCAAAATAGG + Intergenic
1045947771 8:107816022-107816044 TTTAAAAAAGAAATCAAAATTGG - Intergenic
1046019276 8:108644946-108644968 TTTCTCAAAGAATTTAAAACAGG + Intronic
1046062186 8:109152707-109152729 TTTCTCAAATGGAAGAAAATAGG + Intergenic
1046208304 8:111033410-111033432 TTTCTCAAATAAATTAAAACAGG - Intergenic
1046276636 8:111970296-111970318 TTTCTCAAAAAATTAAAAATAGG + Intergenic
1046395814 8:113637401-113637423 TTTCTCAATGGAATTAATCTAGG - Intergenic
1046432603 8:114148790-114148812 TTCCTCAAAGAAATTAAAACAGG - Intergenic
1046597734 8:116281119-116281141 GTTTTCAAAGGAATCAGACTTGG + Intergenic
1047967781 8:130059464-130059486 TGTCTCAAAAAAATTAAAATGGG - Intronic
1048088561 8:131212346-131212368 TTTTTCAAAGAACTAAAAATAGG - Intergenic
1048495352 8:134930902-134930924 TTTCTCAAAAGAAAGAAAAAAGG + Intergenic
1049652807 8:143781973-143781995 CTTCTCAAAGAAATCAGAAAAGG - Intergenic
1049829329 8:144690045-144690067 TTTCTCAAAAAATTAAAAATAGG - Intergenic
1049924126 9:392491-392513 TTTCTCAAAGCACTAAAATTAGG + Intronic
1050567880 9:6905577-6905599 TTTCTCAAAAGAATCATTTTAGG - Intronic
1050662200 9:7894843-7894865 TTTTTAAAACTAATCAAAATGGG - Intergenic
1050860751 9:10427359-10427381 TTTCTAAAAGGAATTATAAAAGG - Intronic
1050947053 9:11537383-11537405 TTTCTCAAAGCAATTAAATGGGG + Intergenic
1051069260 9:13143562-13143584 TTTCTAAAAGGAAACATAAGAGG + Exonic
1051976622 9:22957946-22957968 TTTCTCAAAAAACTTAAAATGGG - Intergenic
1051997979 9:23242323-23242345 TTTCTCAAAAAACTAAAAATAGG + Intergenic
1052015348 9:23457715-23457737 TTCTACAAAGGAATAAAAATTGG + Intergenic
1052080987 9:24204809-24204831 TTTCTCAGAGAAGTAAAAATTGG - Intergenic
1052371535 9:27670864-27670886 TTTCTCAAAAGGAGGAAAATAGG - Intergenic
1052491176 9:29170045-29170067 TTTCTCAAATAACTAAAAATGGG + Intergenic
1052722009 9:32183194-32183216 TTTATGAATGGAATCAATATGGG + Intergenic
1052743927 9:32421152-32421174 TTTCTCCATGGAGTCAAAATGGG + Intronic
1053181837 9:35979070-35979092 TTTCTCACAAGAAACAAAACAGG - Intergenic
1054891075 9:70252534-70252556 CTTCCCAAAGGAAAGAAAATTGG - Intergenic
1054970925 9:71085791-71085813 TTTCTCAAAGAACTTAAAATAGG + Intronic
1055972711 9:81927863-81927885 TTTCTCAAAAAAATCAAATTGGG + Intergenic
1055974464 9:81942935-81942957 TTTCTCAAAAAAATCAAATTGGG + Intergenic
1056446265 9:86668901-86668923 TATATAAAAAGAATCAAAATGGG + Intergenic
1057110768 9:92468826-92468848 TTTCTCAAAGGAAATCAAGTAGG + Intronic
1057912319 9:99029409-99029431 TTTCTCCAAGCAATCCCAATTGG + Intronic
1058125715 9:101192295-101192317 TTTCTCTAAAGAAGCAAAAGAGG + Intronic
1058355151 9:104075932-104075954 TTTGTCAGTGGAATCTAAATTGG + Intergenic
1059056192 9:110983104-110983126 TTCCTCAAAAAAATTAAAATAGG + Intronic
1059410919 9:114131817-114131839 TTTTTCAAAAGAAGAAAAATAGG - Intergenic
1060181135 9:121534705-121534727 TTTCTAAAAAGAATCAAATGAGG + Intergenic
1061125128 9:128670134-128670156 TGTCTCAAAGGAAAAAAAAAAGG + Intergenic
1061356338 9:130108357-130108379 TTTCTAAAATGAATCTACATTGG - Intronic
1203519408 Un_GL000213v1:32436-32458 TTTTTCAAAGATGTCAAAATAGG - Intergenic
1185862790 X:3594569-3594591 TGTCTCAAAGGAAAAAAAAATGG + Intergenic
1187176792 X:16903091-16903113 TTTCACAAAGCAAATAAAATGGG - Intergenic
1187192452 X:17047930-17047952 TTTCTGAGAGAAATTAAAATGGG + Intronic
1187533219 X:20115223-20115245 TTTTTTAATGGAAACAAAATTGG - Intronic
1187853652 X:23615877-23615899 TTTCTCAAAGAACTTAAAACAGG + Intergenic
1188140891 X:26549335-26549357 TTTCTCAAAAGTGTCCAAATGGG - Intergenic
1188152291 X:26692787-26692809 TTTCTCAAAAAATTAAAAATAGG - Intergenic
1188953596 X:36407467-36407489 TTTCTCAAAGAACTGAAGATTGG + Intergenic
1190004048 X:46717680-46717702 TTTCTGAAATGAATAAAGATTGG - Intronic
1190013378 X:46804885-46804907 TTTCTGAAAATAAACAAAATCGG - Intergenic
1190384895 X:49875490-49875512 TATCTCAGGGGAATAAAAATGGG + Intergenic
1190477721 X:50844282-50844304 TTTCTTTAAAGAATCAAAGTTGG - Intergenic
1190863658 X:54366776-54366798 TTTCTCAAAAAATTAAAAATAGG + Intergenic
1192068065 X:67907567-67907589 TTTCTCAAAAAACTAAAAATAGG + Intergenic
1192091841 X:68167211-68167233 TTTCTCAAAAGAAGACAAATGGG + Intronic
1192409223 X:70918063-70918085 ATTCCCAAAGGAATTGAAATCGG - Intergenic
1193162955 X:78248662-78248684 ATTCTCAAAGAACTAAAAATAGG - Intergenic
1193430765 X:81401289-81401311 TTTCTTAAAGAACTAAAAATAGG - Intergenic
1193502995 X:82303187-82303209 TTTCTCAAAGAACTTAAAACTGG + Intergenic
1194423318 X:93704327-93704349 TTTCTTAAAGGATTTAAGATAGG - Intronic
1194884815 X:99300890-99300912 TTTTTCAAAGCAAGCCAAATAGG - Intergenic
1195403328 X:104485463-104485485 TTTTTTAAAGAAAACAAAATGGG - Intergenic
1195837331 X:109131733-109131755 TTTATTAAAGGAATCAGAGTAGG + Intergenic
1195987845 X:110650232-110650254 TATCTCAAAGAACTAAAAATAGG - Intergenic
1196264211 X:113622662-113622684 TTTCACAAATGAATGACAATTGG - Intergenic
1196643103 X:118086313-118086335 TTTCTCAAAGAACTAAAAGTAGG - Intronic
1196708579 X:118739086-118739108 TTTCTCAAAGAACTTAAAATAGG - Intronic
1197670740 X:129274218-129274240 TGTCTCAAAGAAAAAAAAATGGG - Intergenic
1198957966 X:142152495-142152517 TTTCTCAAAGAACTTAAAACAGG - Intergenic
1199391365 X:147283410-147283432 TTTCTCAAGGGAGAGAAAATAGG + Intergenic
1199391583 X:147286109-147286131 TTTCTCAAGGGAGAGAAAATAGG + Intergenic
1199395133 X:147328040-147328062 TTTCTCAAAAAACTTAAAATAGG - Intergenic
1199526620 X:148799528-148799550 CTTCTCAAAGAAATGTAAATAGG - Intronic
1199779948 X:151049170-151049192 ATTGTCAAAGGAATAAAAACCGG - Intergenic
1199780534 X:151054806-151054828 TTTCTGATAGGAATACAAATTGG - Intergenic
1199945559 X:152663508-152663530 TTTCTCAAATAACTCAAAACAGG - Intergenic
1200309284 X:155061157-155061179 TCTATAAAAGGTATCAAAATTGG + Intergenic
1201165814 Y:11207594-11207616 TGTCTCAAAGCAAACAAAACAGG - Intergenic
1201636750 Y:16131693-16131715 TTCCTTAAAGGCATCAAACTTGG + Intergenic