ID: 922407333

View in Genome Browser
Species Human (GRCh38)
Location 1:225328811-225328833
Sequence TTTCTCAAAGGAATCAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 654}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922407328_922407333 25 Left 922407328 1:225328763-225328785 CCATGCGTTAATATGTAAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407327_922407333 26 Left 922407327 1:225328762-225328784 CCCATGCGTTAATATGTAAGTAA No data
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654
922407326_922407333 27 Left 922407326 1:225328761-225328783 CCCCATGCGTTAATATGTAAGTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 922407333 1:225328811-225328833 TTTCTCAAAGGAATCAAAATGGG 0: 1
1: 0
2: 4
3: 62
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922407333 Original CRISPR TTTCTCAAAGGAATCAAAAT GGG Intronic