ID: 922410414

View in Genome Browser
Species Human (GRCh38)
Location 1:225368617-225368639
Sequence CAATTGCAAGAAAATTAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1461
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 1401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922410414 Original CRISPR CAATTGCAAGAAAATTAACC CGG (reversed) Intronic
900845715 1:5098604-5098626 AAAATACAAAAAAATTAACCAGG + Intergenic
901517591 1:9759434-9759456 CAATAACAAAAAAATTAGCCAGG - Intronic
901597447 1:10396762-10396784 AAAATACAAAAAAATTAACCGGG + Intergenic
902100013 1:13979768-13979790 AAATACCAAAAAAATTAACCAGG + Intergenic
902305489 1:15535245-15535267 CAATGACAAGAAAATTGACCTGG - Intronic
902537312 1:17127213-17127235 AAAATGCAAAAAAATTAACCAGG + Intergenic
902595035 1:17503667-17503689 AAAATGCAAAAAAATTAGCCAGG - Intergenic
902920178 1:19661356-19661378 AAAATGCAAAAAAATTAGCCGGG - Intergenic
902942730 1:19812313-19812335 AAAATACAAAAAAATTAACCAGG - Intergenic
903112311 1:21146594-21146616 AAAATACAAAAAAATTAACCGGG + Intronic
903350989 1:22716490-22716512 AAAATGCAAAAAAATTAGCCGGG - Intronic
903513632 1:23895059-23895081 AAAATACAAAAAAATTAACCAGG + Intronic
903550439 1:24154058-24154080 CAAAAACAAAAAAATTAACCAGG + Intergenic
903556127 1:24194742-24194764 AAAATACAAAAAAATTAACCAGG - Intergenic
904084824 1:27898704-27898726 AAAATACAAAAAAATTAACCAGG - Intronic
904166213 1:28557257-28557279 AAAATACAAGAAAATTAGCCAGG + Intronic
904166409 1:28558723-28558745 AAAATGCAAAAAAATTAGCCAGG - Intronic
904224729 1:29006737-29006759 CAAATACAAAAAAATTAGCCAGG + Intronic
904791582 1:33026356-33026378 CAATTACATAAAAATTAGCCAGG - Intronic
905528065 1:38654435-38654457 CAAATACAAAAAAATTAGCCAGG + Intergenic
905685412 1:39903882-39903904 AAAATACAAGAAAATTAGCCGGG + Intergenic
905714623 1:40137872-40137894 AAAATGCAAAAAAATTAACCAGG + Intergenic
906159112 1:43634661-43634683 AAATACCAAGAAAATTATCCAGG + Intergenic
906354677 1:45094355-45094377 AAAATGCAAAAAAATTAGCCAGG - Intronic
906449687 1:45934323-45934345 AAATTACAAAAAAATTAGCCGGG + Intronic
906623304 1:47303402-47303424 CAAATACAAAAAAATTAGCCAGG + Intronic
906764657 1:48417653-48417675 CAAATACAAAAAAATTAGCCAGG + Intronic
906803780 1:48760154-48760176 CATTTACAAGAGAATTATCCAGG + Intronic
907092425 1:51739245-51739267 CAATTGAAAAAAAATTCAGCTGG + Intronic
907098178 1:51801003-51801025 CAAAAGCAAAAAAATTAGCCGGG - Intronic
907187817 1:52624345-52624367 AAAATACAAAAAAATTAACCAGG + Intergenic
907196776 1:52693414-52693436 AAAATGCAAAAAAATTAGCCAGG + Intronic
907864637 1:58387885-58387907 AAAATACAAAAAAATTAACCAGG - Intronic
908051958 1:60242944-60242966 CAATAGCAAGAAATAAAACCTGG - Intergenic
908119273 1:60970518-60970540 ATATTCCAAGAAAATTAACGTGG + Intronic
908235947 1:62147495-62147517 CAAATACAAAAAAATTAGCCAGG + Intronic
908246377 1:62230539-62230561 AAAATACAAAAAAATTAACCAGG - Intergenic
908344099 1:63213772-63213794 AAAATGCAAAAAAATTAGCCAGG + Intergenic
909012647 1:70352177-70352199 AAATTACAAAAAAATTAGCCTGG + Intronic
909289045 1:73858968-73858990 CAAATGCAAAAAAATTAGCCAGG - Intergenic
909632440 1:77781065-77781087 CAAATACAAAAAAATTAGCCAGG - Intronic
909634175 1:77796800-77796822 CAATTGAAAAAAAATCAACCAGG - Intronic
909854049 1:80505855-80505877 AAAATGCAAAAAAATTAACCAGG - Intergenic
909888228 1:80969702-80969724 AAAATACAAAAAAATTAACCAGG - Intergenic
909998724 1:82315276-82315298 TAAATGCAAGAAAATGTACCAGG + Intergenic
910136798 1:83981669-83981691 AAATAGCAAAAAAATTAGCCAGG + Intronic
910998772 1:93139548-93139570 AAAATGCAAAAAAATTAGCCTGG + Intergenic
911330380 1:96519677-96519699 AAATTACAAAAAAATTAGCCGGG - Intergenic
911624194 1:100102516-100102538 AAATTGCAAAAAAATTAGCTGGG + Intronic
911656837 1:100453798-100453820 AAAATACAAAAAAATTAACCAGG - Intronic
911819599 1:102400588-102400610 GAAATACAAAAAAATTAACCAGG - Intergenic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
912224177 1:107713497-107713519 AAATAGCAAGAAAATTAGCAGGG + Intronic
912343028 1:108936253-108936275 AAAATACAAGAAAATTAGCCAGG - Intronic
912436659 1:109666884-109666906 AAAATGCAAAAAAATTAGCCAGG - Intronic
912610503 1:111037839-111037861 AAATTACAAAAAAATTAGCCGGG + Intergenic
912674426 1:111664211-111664233 CAAATACAAAAAAATTATCCGGG + Intronic
912783311 1:112574073-112574095 AAAATACAAAAAAATTAACCGGG - Intronic
912814590 1:112818825-112818847 AAAGTACAAAAAAATTAACCAGG + Intergenic
912819925 1:112858891-112858913 AAATTACAAAAAAATTAGCCGGG + Intergenic
912848703 1:113102428-113102450 AAAATACAAAAAAATTAACCGGG - Intronic
912938148 1:114021560-114021582 CAAATACAAAAAAATTAGCCGGG - Intergenic
913427964 1:118755812-118755834 AAAATACAAAAAAATTAACCAGG + Intergenic
914045687 1:144089991-144090013 AAAATGCAAAAAAATTAGCCGGG + Intergenic
914132423 1:144870695-144870717 AAAATGCAAAAAAATTAGCCGGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914391184 1:147224668-147224690 AAAATGCAAAAAAATTAGCCGGG - Intronic
914782690 1:150800034-150800056 AAAATGCAAAAAAATTAGCCAGG + Intronic
914864535 1:151415508-151415530 AAAATGCAAAAAAATTAGCCGGG + Intronic
915247012 1:154563294-154563316 AAAATGCAAAAAAATTAGCCGGG + Intergenic
915338858 1:155165423-155165445 AAAATGCAACAAAATTAGCCAGG + Intergenic
915372703 1:155364779-155364801 AAAATACAAAAAAATTAACCAGG + Intronic
915397329 1:155595336-155595358 AAAATACAAAAAAATTAACCAGG - Intergenic
915531858 1:156507264-156507286 AAAATACAAAAAAATTAACCAGG + Intergenic
915863990 1:159478381-159478403 AAAATGCAAAAAAATTAGCCAGG - Intergenic
916043503 1:160981415-160981437 AAAATACAAAAAAATTAACCGGG - Intergenic
916089207 1:161294075-161294097 AAAATACAAGAAAATTAGCCAGG + Intergenic
916486582 1:165265041-165265063 AAAATGCAAAAAAATTAGCCGGG + Intronic
916540212 1:165746146-165746168 CAATGATAAGAAAATTAGCCAGG + Intronic
917062345 1:171055085-171055107 CAATTGCAAAAATATAAAACTGG + Intronic
917156959 1:172013158-172013180 CAGTTGCCAGAAAAGTAATCTGG - Intronic
917234359 1:172874316-172874338 CCATTGCAAGAGAAGTAACCTGG + Intergenic
917376359 1:174351960-174351982 CAAAAGCAAAAAAATTAGCCAGG - Intronic
918063471 1:181082833-181082855 AAAATACAAAAAAATTAACCAGG + Intergenic
918642221 1:186856548-186856570 AAAATACAAGAAAATTAGCCAGG - Intronic
919034841 1:192293359-192293381 CAAATCCAAAAAAATTAGCCGGG - Intergenic
919186300 1:194155412-194155434 TAATGGAAAGAAAATTAAACTGG + Intergenic
919404723 1:197165447-197165469 AAAATGCAAAAAAATTAGCCGGG + Intronic
919663580 1:200271171-200271193 AAAATACAAGAAAATTAGCCAGG - Intergenic
919713015 1:200747053-200747075 CATTTTCAAAAAAATTAGCCAGG - Intronic
919831895 1:201547145-201547167 AAATTACAAAAAAATTAGCCGGG - Intergenic
919903604 1:202061889-202061911 AAAATGCAAAAAAATTAGCCAGG + Intergenic
920360046 1:205408656-205408678 TAATTGCAAAAAAATTAGCTGGG - Intronic
920558346 1:206920710-206920732 CAAGTTTAAGAAAATTAATCTGG + Intronic
921050399 1:211506984-211507006 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921718049 1:218438946-218438968 AAAATACAAAAAAATTAACCAGG + Intronic
921723772 1:218502237-218502259 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921856053 1:219985561-219985583 AAAATACAAAAAAATTAACCAGG - Intronic
922051794 1:221997822-221997844 GAAGTACAAAAAAATTAACCAGG + Intergenic
922141442 1:222891973-222891995 CAAGAGCAAGAAAATTAATGGGG + Intronic
922231198 1:223688240-223688262 AAATTAAAAAAAAATTAACCTGG - Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
922439549 1:225642038-225642060 CAAATACAAAAAAATTAGCCAGG + Intronic
922491937 1:226024833-226024855 AAAATGCAAAAAAATTAGCCAGG + Intergenic
923164248 1:231344344-231344366 AAATTGAAAAAAAATTAGCCAGG + Intronic
923177462 1:231480863-231480885 AAAATACAAAAAAATTAACCGGG - Intergenic
924012807 1:239684534-239684556 AAAATGCAAAAAAATTAGCCGGG + Intronic
924533353 1:244912464-244912486 AAAATACAAAAAAATTAACCAGG - Intergenic
924757637 1:246956146-246956168 AAAATGCAAAAAAATTAGCCGGG - Intronic
1063465470 10:6241063-6241085 AAAATACAAAAAAATTAACCAGG - Intergenic
1063483066 10:6393730-6393752 AAAATACAAAAAAATTAACCAGG - Intergenic
1063679448 10:8173035-8173057 AAACTGCAAAAAAATTAGCCAGG - Intergenic
1063686258 10:8239790-8239812 CAATTGCAAGAAGATCATTCAGG - Intergenic
1063842049 10:10083159-10083181 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1063846683 10:10136403-10136425 AAAATACAAAAAAATTAACCAGG - Intergenic
1064068741 10:12206796-12206818 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064090607 10:12380052-12380074 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064258413 10:13765273-13765295 AAAATGCAAAAAAATTAGCCAGG - Intronic
1064393502 10:14960866-14960888 AAAATACAAAAAAATTAACCAGG + Intronic
1064435842 10:15310699-15310721 CAAATACAAAAAAATTAGCCAGG + Intronic
1064443427 10:15372535-15372557 AAAATACAAAAAAATTAACCAGG + Intergenic
1065079749 10:22116347-22116369 AAAATTCAAAAAAATTAACCAGG - Intergenic
1065224552 10:23529858-23529880 CAACTGCCAGAAAATAAAGCTGG + Intergenic
1065446666 10:25809412-25809434 AAAATACAAAAAAATTAACCAGG + Intergenic
1065513425 10:26502479-26502501 CAAATACAAAAAAATTAGCCAGG + Intronic
1065536421 10:26719208-26719230 AAATTTCAAGAAAATCAAACTGG - Intronic
1065567482 10:27028434-27028456 AAAATACAAAAAAATTAACCGGG + Intronic
1066375125 10:34851186-34851208 AAAATACAAGAAAATTAGCCAGG - Intergenic
1066419288 10:35249091-35249113 AAATTTCAAAAAAATTAGCCAGG - Intronic
1066536049 10:36393312-36393334 AAAATACAAAAAAATTAACCAGG + Intergenic
1066542342 10:36460768-36460790 GAAATGCAAAAAAATTAGCCGGG - Intergenic
1066636335 10:37505409-37505431 AAATTACATAAAAATTAACCTGG - Intergenic
1066701687 10:38136302-38136324 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1067102835 10:43345239-43345261 AAATTACAAAAAAATTAGCCAGG + Intergenic
1067308170 10:45086090-45086112 AAATTACAAAAAAATTAGCCAGG + Intergenic
1067369509 10:45670385-45670407 AAAATGCAAAAAAATTAGCCGGG - Intronic
1067380542 10:45769276-45769298 AAAATACAAGAAAATTAGCCGGG - Intronic
1067888240 10:50109928-50109950 AAAATACAAGAAAATTAGCCGGG - Intronic
1067991762 10:51222033-51222055 CAAATACAAAAAAATTAGCCAGG - Intronic
1068297249 10:55088427-55088449 AAAATACAAAAAAATTAACCTGG - Intronic
1068307880 10:55238308-55238330 AAAATACAAGAAAATTAGCCGGG - Intronic
1068594089 10:58883709-58883731 CAATGTCAAGAAAATTGCCCCGG + Intergenic
1068620777 10:59179105-59179127 CAATTCCAAAAATATTAACTTGG + Intronic
1069011498 10:63378429-63378451 AAAATACAAAAAAATTAACCGGG + Intronic
1069466387 10:68643098-68643120 CAAATACAAAAAAATTAGCCAGG + Intronic
1069697876 10:70400567-70400589 AAAATACAAAAAAATTAACCGGG + Intergenic
1069706934 10:70464784-70464806 AAATTACAAAAAAATTAGCCGGG - Intergenic
1070086062 10:73238184-73238206 AAAATACAAGAAAATTAGCCAGG + Intronic
1070146531 10:73778017-73778039 CAAATACAAAAAAATTAGCCAGG - Intronic
1070294443 10:75147484-75147506 AAAATGCAAAAAAATTAGCCAGG - Intronic
1070308449 10:75255201-75255223 AAAATACAAAAAAATTAACCAGG - Intergenic
1070315632 10:75309000-75309022 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1070380030 10:75872462-75872484 AAAATACAAAAAAATTAACCAGG - Intronic
1071277589 10:84069713-84069735 AAATTACAAAAAAATTAGCCGGG + Intergenic
1071546270 10:86532148-86532170 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1071826540 10:89331330-89331352 AAAATACAAAAAAATTAACCAGG - Intronic
1072353125 10:94577900-94577922 AAATTACAAAAAAATTAGCCGGG + Intronic
1072585420 10:96777519-96777541 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1072604166 10:96965167-96965189 AAAATGCAAAAAAATTAGCCAGG - Intronic
1072645025 10:97247148-97247170 AAATTACAAAAAAATTAGCCGGG + Intronic
1073005538 10:100321297-100321319 AAAATACAAAAAAATTAACCAGG + Intronic
1073748191 10:106493885-106493907 CAACTGCAAGAAACTGAATCTGG + Intergenic
1074124995 10:110521678-110521700 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1074368248 10:112877549-112877571 AAATTACAAAAAAATTAGCCGGG - Intergenic
1074505583 10:114067588-114067610 AAATTACAAAAAAATTAGCCAGG - Intergenic
1074954937 10:118379671-118379693 AAATTACAAAAAAATTAGCCAGG - Intergenic
1075208418 10:120467237-120467259 AAATTACAAAAAAATTAGCCAGG - Intronic
1076008551 10:126967972-126967994 AAATTACAAGAAAAATAGCCGGG - Intronic
1076062133 10:127421075-127421097 CAAGTACAAAAAAATTAGCCGGG - Intronic
1076359231 10:129875354-129875376 CAAATGCCAAAAAATTAGCCAGG - Intronic
1076863325 10:133153393-133153415 AAAATACAAAAAAATTAACCAGG + Intergenic
1077648570 11:3948930-3948952 CAATTACAACAAAAATAACATGG + Intronic
1077831023 11:5870401-5870423 AAAATACAAAAAAATTAACCGGG + Intronic
1077899152 11:6475847-6475869 AAAATGCAAGAAAATTAGCCCGG - Exonic
1078201124 11:9184190-9184212 AAAATGCAAAAAAATTAGCCGGG + Intronic
1078208269 11:9249065-9249087 CAAATACAAAAAAATTAGCCGGG + Intronic
1078530455 11:12132789-12132811 CATTTGCTAGAGAATTAAACTGG - Intronic
1078577716 11:12515995-12516017 AAAATACAAAAAAATTAACCGGG - Intronic
1078587685 11:12607883-12607905 AAATTACAAAAAAATTAGCCGGG + Intergenic
1078999703 11:16740933-16740955 AAAATACAAAAAAATTAACCGGG + Intronic
1079051785 11:17167129-17167151 CAATTACAAAAAAATTAGCTGGG - Intronic
1079060671 11:17246130-17246152 AAAATACAAAAAAATTAACCAGG + Intronic
1079222714 11:18577709-18577731 AAAATACAAGAAAATTAGCCGGG + Intronic
1079738142 11:24023584-24023606 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1079862552 11:25692385-25692407 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1079893760 11:26092783-26092805 AAAATACAAAAAAATTAACCGGG - Intergenic
1080214407 11:29824906-29824928 CCATGGCAAGAACATTAGCCAGG + Intergenic
1080259552 11:30332702-30332724 TAAGTGCAAGAAAATTTACATGG - Intronic
1080962073 11:37172365-37172387 AAATTAAAAAAAAATTAACCAGG + Intergenic
1081178483 11:39958486-39958508 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1081457711 11:43241641-43241663 AAAATACAAAAAAATTAACCAGG + Intergenic
1081594467 11:44449763-44449785 CATATGCAAGAAAATAAAGCAGG + Intergenic
1082117539 11:48343649-48343671 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1082697432 11:56386824-56386846 AAAATACAAAAAAATTAACCGGG + Intergenic
1082920057 11:58483217-58483239 ATATTGAAAGAAAATTAACTTGG + Intergenic
1083346616 11:61997821-61997843 AAAATACAAAAAAATTAACCGGG + Intergenic
1083368607 11:62159379-62159401 CAATGAGAAGAAAATTAACAAGG + Intergenic
1084018587 11:66402931-66402953 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1084027441 11:66460572-66460594 CAAATACAAAAAAATTAGCCGGG - Intronic
1084082436 11:66837285-66837307 CAAATACAAAAAAATTAGCCAGG - Intronic
1084103270 11:66964115-66964137 AAAATACAAGAAAATTAGCCGGG - Intergenic
1084830325 11:71763750-71763772 AAAATGCAAAAAAATTAGCCCGG + Intergenic
1084910899 11:72388409-72388431 AAAATGCAAAAAAATTAGCCGGG - Intronic
1085065564 11:73492479-73492501 AAATTTCAAAAAAATTAGCCGGG + Intronic
1085503712 11:77043544-77043566 AAAATACAAAAAAATTAACCGGG + Intergenic
1085672391 11:78480243-78480265 AAAATGTAAGAAAATAAACCAGG - Intronic
1085794820 11:79529390-79529412 CAATTGCAATTAGATTAACAAGG - Intergenic
1086056967 11:82658242-82658264 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1086326182 11:85702348-85702370 CCTTTGCAAAGAAATTAACCAGG - Intronic
1086348426 11:85921339-85921361 AAATTACAAAAAAATTAGCCAGG + Intergenic
1086431937 11:86744514-86744536 AAAATACAAAAAAATTAACCGGG + Intergenic
1086689152 11:89769019-89769041 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1086806043 11:91243825-91243847 CAATTGCAAGAAGGCTAGCCAGG + Intergenic
1087725558 11:101712223-101712245 CATATGCAAGAAAATGAAACTGG + Intronic
1087785788 11:102352569-102352591 AAAATACAAAAAAATTAACCAGG - Intronic
1088229602 11:107660141-107660163 TAATTGCAAGAATATTACACAGG - Intronic
1088454220 11:110016644-110016666 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1088671020 11:112140695-112140717 CAATTAAAAAAAAATTAGCCAGG + Intronic
1088937834 11:114421459-114421481 CATTGGAAACAAAATTAACCAGG - Intronic
1089073312 11:115717530-115717552 GAATAGCAATAAAATAAACCAGG - Intergenic
1089259685 11:117215559-117215581 CAAATACAAAAAAATTAGCCAGG - Intronic
1089549825 11:119265035-119265057 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089567561 11:119380073-119380095 AAATTACAAAAAAATTAGCCGGG - Intronic
1089654628 11:119938072-119938094 CACTGACAAGAAAATTCACCTGG + Intergenic
1089767773 11:120780900-120780922 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089788262 11:120923571-120923593 CAAATACAAAAAAATTAGCCAGG - Intronic
1089968642 11:122674539-122674561 AAAATGCAAAAAAATTAGCCGGG - Intronic
1090053719 11:123403264-123403286 AAATTACAAAAAAATTAGCCAGG + Intergenic
1090182359 11:124711494-124711516 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1090328482 11:125909808-125909830 CAAATACAAAAAAATTAGCCAGG - Intronic
1090968028 11:131615524-131615546 AAATTACAAAAAAATTAGCCAGG - Intronic
1091523341 12:1270366-1270388 AAAATGCAAAAAAATTAGCCAGG - Intronic
1091819746 12:3467077-3467099 AAAATACAAAAAAATTAACCGGG + Intronic
1092136976 12:6156249-6156271 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1092494510 12:8979173-8979195 AAATACAAAGAAAATTAACCAGG - Intronic
1092600427 12:10055896-10055918 AAAATGCAAAAAAATTAGCCGGG + Intronic
1092625133 12:10318683-10318705 CAAGTACAAAAAAATTAGCCAGG + Intergenic
1092814127 12:12297984-12298006 CAATTAAAAAAAAATTAGCCAGG + Intergenic
1093001318 12:13999897-13999919 AAAATACAAAAAAATTAACCGGG - Intergenic
1093127534 12:15348624-15348646 AAAATACAAAAAAATTAACCGGG + Intronic
1093185779 12:16017698-16017720 CACTTGGAAAAAAATTAAGCAGG - Intronic
1093195414 12:16124546-16124568 CAATTAAGAGAAAATGAACCAGG - Intergenic
1093777057 12:23088128-23088150 CAATTGGAAGAAAAGTCACTAGG - Intergenic
1094431797 12:30378193-30378215 AAAATACAAAAAAATTAACCAGG - Intergenic
1094643637 12:32300260-32300282 AAAATACAAGAAAATTAGCCAGG - Intronic
1095267876 12:40181172-40181194 AAAATACAAAAAAATTAACCAGG + Intergenic
1095311390 12:40701705-40701727 AGATTGCTTGAAAATTAACCTGG + Intronic
1095764254 12:45876929-45876951 AAAATACAAAAAAATTAACCAGG + Intronic
1095868897 12:47003799-47003821 AAAATACAAAAAAATTAACCGGG - Intergenic
1095897247 12:47292259-47292281 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1095912172 12:47439313-47439335 AAATACCAAAAAAATTAACCAGG + Intergenic
1096209496 12:49753234-49753256 CAGTTGCCAGAAAATTAAAATGG - Intronic
1096275949 12:50208323-50208345 AAAATGCAAAAAAATTAGCCAGG + Intronic
1097120825 12:56730526-56730548 AAAATACAAGAAAATTAGCCAGG - Intronic
1097163611 12:57068724-57068746 AAAATGCAAAAAAATTAGCCAGG - Intronic
1097210412 12:57364306-57364328 AAAATGCAAAAAAATTAGCCAGG - Intronic
1097236430 12:57543186-57543208 AAAATACAAGAAAATTAGCCGGG + Intronic
1097605226 12:61745554-61745576 CCATGGGAAGAAAATTAAGCAGG - Intronic
1098862383 12:75724540-75724562 AAAATACAAAAAAATTAACCGGG - Intergenic
1098914143 12:76239900-76239922 AAAATACAAAAAAATTAACCAGG + Intergenic
1098924043 12:76329478-76329500 ATATTTTAAGAAAATTAACCTGG - Intergenic
1099057807 12:77867578-77867600 AAAATGCAAAAAAATTAGCCGGG - Intronic
1099129905 12:78815530-78815552 CAATTACATGGAAATTAAACAGG + Intergenic
1099164767 12:79290521-79290543 CAAATGCAAGAAGTATAACCAGG - Intronic
1099470380 12:83040843-83040865 AAATTACAAAAAAATTAGCCGGG - Intronic
1099662226 12:85578556-85578578 GAAATACAAAAAAATTAACCAGG + Intergenic
1100382621 12:94075660-94075682 GAATGGCAAGAAAATAAACTGGG - Intergenic
1100399468 12:94216105-94216127 CAAATACAAAAAAATTAGCCAGG + Intronic
1100510956 12:95272906-95272928 AAAATGCAAAAAAATTAGCCAGG - Intronic
1100696400 12:97098704-97098726 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1100790030 12:98120197-98120219 AAAATCCAAGAAAATTAACTGGG - Intergenic
1101101668 12:101400086-101400108 AAAATACAAGAAAATTAACCGGG - Intronic
1101373457 12:104151186-104151208 TAATTAAAAAAAAATTAACCAGG - Intergenic
1102106205 12:110325825-110325847 AAATACCAAAAAAATTAACCCGG + Intronic
1102188697 12:110969526-110969548 GAAATGCAAAAAAATTAGCCAGG - Intergenic
1102242733 12:111335230-111335252 AAAATACAAAAAAATTAACCAGG + Intronic
1102378340 12:112441935-112441957 AAAATGCAAAAAAATTAGCCAGG - Intronic
1102397265 12:112597422-112597444 AAAATGCAAAAAAATTAGCCAGG + Intronic
1102713335 12:114948040-114948062 AAAATACAAAAAAATTAACCAGG - Intergenic
1102752020 12:115303181-115303203 AAATGGAAATAAAATTAACCTGG + Intergenic
1102971698 12:117173187-117173209 AAAATGCAAAAAAATTAGCCAGG - Intronic
1103292144 12:119855260-119855282 AAATTACAAAAAAATTAGCCGGG + Intronic
1103453411 12:121045906-121045928 CAATTTTCTGAAAATTAACCAGG - Intergenic
1103507353 12:121450697-121450719 AAAATGCAAAAAAATTAGCCAGG + Intronic
1103515754 12:121507203-121507225 AAATTACAAAAAAATTAGCCAGG + Intronic
1103521730 12:121540590-121540612 AAAATGCAAAAAAATTAGCCGGG + Intronic
1103629142 12:122245602-122245624 AAAATACAAGAAAATTAGCCGGG - Intronic
1103826234 12:123741288-123741310 CAATAGAAAAAAAATTAGCCAGG + Intronic
1104203321 12:126613440-126613462 GAATTGTAAGAAAATTAAAAGGG - Intergenic
1104861910 12:131928493-131928515 AAAATACAAAAAAATTAACCGGG + Intergenic
1105045466 12:132999828-132999850 TAAATACAAAAAAATTAACCGGG - Intronic
1105515061 13:21082044-21082066 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1105629793 13:22150967-22150989 CAATTTCAATAAAATTAAAGGGG + Intergenic
1106088998 13:26570125-26570147 AAATTACAAAAAAATTAGCCGGG + Intronic
1106438235 13:29742556-29742578 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1106456337 13:29930565-29930587 TAAATGCAAAAAAATTAGCCAGG - Intergenic
1106471143 13:30055460-30055482 AAAATACAAAAAAATTAACCGGG + Intergenic
1106852165 13:33805443-33805465 CAAATACAAAAAAATTAGCCAGG - Intergenic
1107012943 13:35685719-35685741 AAAATACAAGAAAATTAGCCAGG - Intergenic
1107088390 13:36449800-36449822 AAATGTCAAAAAAATTAACCAGG - Intergenic
1107378023 13:39825583-39825605 AAATTTCTAGAAAATAAACCAGG + Intergenic
1107524407 13:41215421-41215443 AAAATACAAGAAAATTAACTGGG + Intergenic
1108060043 13:46523819-46523841 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108518646 13:51224784-51224806 CAAATGCAAGGAATTTAACGTGG + Intronic
1108548191 13:51517580-51517602 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108611785 13:52090863-52090885 AAAATACAAAAAAATTAACCAGG + Intronic
1108667512 13:52647577-52647599 AAAATACAAGAAAATTAGCCAGG - Intergenic
1109125019 13:58506075-58506097 AAATTACAAAAAAATTAGCCTGG + Intergenic
1109166186 13:59038486-59038508 AAAATACAAAAAAATTAACCGGG + Intergenic
1109224015 13:59670741-59670763 AAAATGCAAAAAAATTAGCCGGG - Intronic
1109276484 13:60309704-60309726 AAATTGCTGGAAAATGAACCAGG + Intergenic
1109432000 13:62248536-62248558 AAAATACAAAAAAATTAACCAGG - Intergenic
1109597237 13:64571656-64571678 AAAATACAAAAAAATTAACCAGG - Intergenic
1109785861 13:67173646-67173668 CACTTGAAAGAAAATGACCCTGG + Intronic
1110027595 13:70560928-70560950 CAATTTTAAGAAAAAAAACCTGG - Intergenic
1110590716 13:77254861-77254883 TAACTGCAATAAAATAAACCAGG - Intronic
1110800396 13:79687323-79687345 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1110938095 13:81317944-81317966 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111660128 13:91199441-91199463 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111669935 13:91318000-91318022 CACTTGAAAGAAACTGAACCTGG - Intergenic
1111728262 13:92040524-92040546 CAAATGCACAAAAATAAACCGGG + Intronic
1111784672 13:92771501-92771523 AAAATGCAAAAAAATTAGCCGGG - Intronic
1112471328 13:99692450-99692472 AAAGTTCAAAAAAATTAACCGGG - Intronic
1112784282 13:102934718-102934740 AAAATGCAACAAAATTAGCCTGG + Intergenic
1113347451 13:109494197-109494219 AAATTACAAAAAAATTAGCCGGG + Intergenic
1113642011 13:111964440-111964462 AAAATTCAAGAAAATTAGCCAGG - Intergenic
1113991576 14:16031431-16031453 AAAATACAAAAAAATTAACCAGG + Intergenic
1114200960 14:20519483-20519505 AAAATACAAGAAAATTAACCAGG + Intergenic
1114294909 14:21320449-21320471 AAAATACAAAAAAATTAACCGGG - Intronic
1114684324 14:24513730-24513752 CAATTTTAAAAAAATTAACATGG - Intergenic
1115060330 14:29180410-29180432 AAAATACAAGAAAATTAGCCGGG + Intergenic
1115250510 14:31341554-31341576 AAATTTTAAGAAAATTATCCGGG - Intronic
1115891414 14:38033627-38033649 AAAATACAAAAAAATTAACCGGG + Intronic
1116236831 14:42289129-42289151 AAAATACAAGAAAATTAGCCAGG - Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116520753 14:45843927-45843949 AAATTGCAACAAAATGAAACAGG - Intergenic
1116830192 14:49712076-49712098 AAAATACAAAAAAATTAACCAGG - Intronic
1117364416 14:55011369-55011391 AAATTACAAAAAAATTAGCCAGG + Intronic
1117423377 14:55570763-55570785 CAGTTACAAGAAAATCAAGCAGG + Intronic
1117886144 14:60365030-60365052 CAACAGCAACAAAATTAGCCGGG - Intergenic
1118163738 14:63316077-63316099 CAATTGGCAGCAAATTCACCTGG - Intronic
1118205320 14:63717480-63717502 AAAATGCAAAAAAATTAGCCGGG - Intronic
1118205387 14:63718085-63718107 AAATTACAAAAAAATTAGCCAGG + Intronic
1118691964 14:68348736-68348758 AAAATACAAAAAAATTAACCAGG + Intronic
1118695547 14:68381513-68381535 AAAATACAAAAAAATTAACCAGG + Intronic
1118792388 14:69106879-69106901 AAAATACAAAAAAATTAACCGGG + Intronic
1118810852 14:69272200-69272222 AAAATACAAAAAAATTAACCGGG + Intronic
1118969263 14:70619295-70619317 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1119009006 14:70964225-70964247 AAAATGCAAAAAAATTAGCCAGG - Intronic
1119271346 14:73307891-73307913 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119762829 14:77164584-77164606 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119811952 14:77528994-77529016 AAAATACAAAAAAATTAACCAGG - Intronic
1120009179 14:79393652-79393674 AAAATACAAAAAAATTAACCGGG + Intronic
1120066381 14:80045834-80045856 AAATTGCCAGAAATCTAACCAGG - Intergenic
1120205409 14:81581980-81582002 AAATTACAAAAAAATTAGCCGGG + Intergenic
1120365478 14:83562835-83562857 AAATTACAAAAAAATTAGCCGGG - Intergenic
1120386939 14:83858210-83858232 AAATTACAAAAAAATTAGCCGGG + Intergenic
1120505140 14:85346480-85346502 CAACAACAACAAAATTAACCAGG + Intergenic
1120752091 14:88207331-88207353 AAAATACAAGAAAATTAGCCGGG - Intronic
1121146258 14:91585175-91585197 CAAATACAAAAAAATTAGCCAGG - Intronic
1121350078 14:93166488-93166510 AAAATACAAAAAAATTAACCGGG + Intergenic
1121354411 14:93201764-93201786 CAAATACAAAAAAATTAGCCAGG + Intronic
1121669044 14:95694025-95694047 AAATTACAAAAAAATTAGCCGGG - Intergenic
1121727628 14:96164807-96164829 AAATTACAAAAAAATTAGCCAGG + Intergenic
1121765964 14:96485954-96485976 AAAATACAAAAAAATTAACCGGG - Intronic
1122593794 14:102874415-102874437 GAAATACAAAAAAATTAACCGGG - Intronic
1122671426 14:103375666-103375688 CAATTTAAAAAAAATTAGCCAGG + Intergenic
1123720716 15:23059446-23059468 AAAATGCAAAAAAATTATCCAGG + Intergenic
1123950311 15:25265803-25265825 AAATTACAAAAAAATTAGCCAGG - Intergenic
1124022245 15:25935388-25935410 AAAATACAAAAAAATTAACCAGG + Intergenic
1124111363 15:26792036-26792058 AAAATACAAAAAAATTAACCGGG + Intronic
1124341464 15:28892233-28892255 AAAATCCAAAAAAATTAACCAGG - Intronic
1124463831 15:29918575-29918597 AAATTACAAAAAAATTAGCCAGG + Intronic
1124517354 15:30377733-30377755 AAAATACAAAAAAATTAACCAGG - Intronic
1124725590 15:32153259-32153281 AAAATACAAAAAAATTAACCAGG + Intronic
1125643043 15:41247509-41247531 AAAATACAAAAAAATTAACCAGG + Intronic
1125668205 15:41449389-41449411 AAAATGCAAAAAAATTAGCCGGG - Intronic
1125896645 15:43308108-43308130 CAAATACAAAAAAATTAGCCGGG - Intergenic
1125952717 15:43767189-43767211 AAAATGCAAAAAAATTAGCCAGG + Intronic
1125954326 15:43778739-43778761 AAACTACAAAAAAATTAACCAGG + Intronic
1126059154 15:44762124-44762146 AAAATGCAAAAAAATTAGCCGGG - Intronic
1126291750 15:47088760-47088782 CAATGGCAAGAAGATTAATATGG + Intergenic
1126458646 15:48892013-48892035 AAAATACAAAAAAATTAACCGGG - Intronic
1126605534 15:50472434-50472456 AAATTACAAAAAAATTAGCCGGG + Intronic
1126611120 15:50530421-50530443 AAAATGCAAAAAAATTAGCCGGG + Intronic
1126622930 15:50658163-50658185 AAAATGCAAAAAAATTAGCCGGG - Intronic
1127018608 15:54718605-54718627 CAAAGGCACGAAAATTAAACTGG - Intergenic
1127307866 15:57725827-57725849 TAAATACAAGAAAACTAACCAGG - Intronic
1127336241 15:57987722-57987744 TAAATACAAAAAAATTAACCAGG + Intronic
1127428156 15:58876139-58876161 AAATTACAAAAAAATTAGCCGGG - Intronic
1127433745 15:58936372-58936394 AAAATGCAAAAAAATTAGCCAGG - Intronic
1127526147 15:59793618-59793640 CATTTGCAGGAAAATTATTCAGG + Intergenic
1127592701 15:60442367-60442389 TAATTACAAGAAAATTAAAAAGG + Intronic
1127753893 15:62071400-62071422 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1128042502 15:64587817-64587839 CATTTTCAGAAAAATTAACCTGG - Intronic
1128193468 15:65727290-65727312 AAAATACAAAAAAATTAACCAGG + Intronic
1128205411 15:65847320-65847342 CAAATACAAAAAAATTAGCCGGG + Intronic
1128462106 15:67878177-67878199 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1128858311 15:71040657-71040679 AAAATGCAAAAAAATTAGCCGGG + Intronic
1129353542 15:74972024-74972046 AAAATACAAAAAAATTAACCAGG - Intronic
1130233008 15:82110898-82110920 AAATTACAAAAAAATTAGCCGGG + Intergenic
1130533635 15:84767153-84767175 AAAATACAAAAAAATTAACCGGG - Intronic
1130665507 15:85866083-85866105 CAAATACAAAAAAATTAGCCAGG - Intergenic
1131128724 15:89879764-89879786 AAAATGCAAAAAAATTAGCCAGG - Intronic
1131349711 15:91687918-91687940 AAATTACAAGAAAATTAGCTGGG + Intergenic
1131763623 15:95651510-95651532 AAAATACAAAAAAATTAACCAGG + Intergenic
1132093783 15:98966888-98966910 CAATTACAAAAACATTAGCCGGG - Intergenic
1132423086 15:101691097-101691119 AAAATGCAAAAAAATTAGCCAGG - Intronic
1132477223 16:146306-146328 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132491320 16:233241-233263 AAAATACAAGAAAATTAGCCAGG - Intergenic
1132652984 16:1029889-1029911 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132818143 16:1845357-1845379 AAAATACAAAAAAATTAACCAGG + Intronic
1132894340 16:2221002-2221024 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1133067999 16:3223717-3223739 AAATTGCTAGAAAATTCACAGGG - Exonic
1133713852 16:8428110-8428132 AAATTACAAAAAAATTAGCCAGG + Intergenic
1133972081 16:10575412-10575434 AAATTACAAAAAAATTAGCCCGG - Intronic
1134085229 16:11352377-11352399 AAAATACAAAAAAATTAACCAGG - Intergenic
1134107030 16:11492622-11492644 AAATTACAAAAAAATTAGCCGGG + Intronic
1134198987 16:12182042-12182064 AAAATACAAAAAAATTAACCAGG - Intronic
1134295425 16:12941191-12941213 AAAATACAAGAAAATTATCCAGG + Intronic
1134354888 16:13472550-13472572 AAAATACAAAAAAATTAACCGGG - Intergenic
1134479077 16:14602089-14602111 AAAGTGCAAAAAAATTAGCCGGG - Intronic
1134558285 16:15185160-15185182 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1134918817 16:18096763-18096785 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1134924946 16:18151184-18151206 AAATTACAAAAAAATTAGCCCGG - Intergenic
1135009698 16:18864354-18864376 AAAATACAAGAAAATTAGCCGGG - Intronic
1135240050 16:20796853-20796875 CAAGGGGAAGAAAATTAGCCTGG - Exonic
1135316729 16:21453277-21453299 AAAATACAAGAAAATTAGCCGGG - Intergenic
1135369652 16:21885520-21885542 AAAATACAAGAAAATTAGCCGGG - Intergenic
1135442162 16:22485604-22485626 AAAATACAAGAAAATTAGCCGGG + Intronic
1135787961 16:25367332-25367354 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1136225722 16:28859100-28859122 CAAATACAAAAAAATTAGCCAGG - Intronic
1136231695 16:28889415-28889437 CAAATGCAAAAAAATTAGCCAGG - Intronic
1136313398 16:29431979-29432001 AAAATACAAGAAAATTAGCCGGG - Intergenic
1136326840 16:29533745-29533767 AAAATACAAGAAAATTAGCCGGG - Intergenic
1136441531 16:30273729-30273751 AAAATACAAGAAAATTAGCCGGG - Intergenic
1136543678 16:30943348-30943370 AAATTACAAAAAAATTAGCCAGG - Intronic
1136593329 16:31231182-31231204 AAAATACAAAAAAATTAACCAGG - Intergenic
1136858454 16:33680110-33680132 AAACTACAAAAAAATTAACCGGG + Intergenic
1137442203 16:48507171-48507193 GAAATACAAAAAAATTAACCAGG - Intergenic
1137650870 16:50119219-50119241 CAAAATCAAGAAAATTAGCCAGG + Intergenic
1137750288 16:50856623-50856645 CAATTGTAAGATAATAAACTGGG - Intergenic
1137782336 16:51108287-51108309 AAATTTCAAAAAAATTAGCCGGG - Intergenic
1138213410 16:55181775-55181797 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1138430892 16:56968344-56968366 AAAATACAAAAAAATTAACCGGG - Intronic
1138435472 16:56997028-56997050 AAAATGCAAAAAAATTAGCCTGG - Intronic
1138620795 16:58209659-58209681 AAAATACAAAAAAATTAACCAGG - Intergenic
1138815082 16:60194482-60194504 AAAATACAAAAAAATTAACCAGG + Intergenic
1138903269 16:61300173-61300195 AAAATACAAAAAAATTAACCAGG - Intergenic
1138977147 16:62221280-62221302 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1139055792 16:63181687-63181709 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1139555506 16:67706896-67706918 AAAATGCAAAAAAATTAGCCAGG + Intronic
1139679697 16:68551917-68551939 AAATTTAAAAAAAATTAACCGGG - Intronic
1139763745 16:69209130-69209152 AAAATACAAGAAAATTAGCCGGG - Intronic
1139773462 16:69297751-69297773 AAAATGCAAAAAAATTAGCCGGG + Intronic
1139852279 16:69958583-69958605 AAAATACAAAAAAATTAACCGGG + Intronic
1139881250 16:70181487-70181509 AAAATACAAAAAAATTAACCGGG + Intronic
1139888324 16:70227463-70227485 AAAATACAAGAAAATTAGCCGGG - Intergenic
1139916553 16:70431801-70431823 AAAATACAAGAAAATTAGCCAGG + Intronic
1140107815 16:71976901-71976923 AAAATGCAAAAAAATTAGCCAGG - Intronic
1140290081 16:73645167-73645189 TTATTGTTAGAAAATTAACCAGG - Intergenic
1140293377 16:73685175-73685197 AAAATACAAGAAAATTAGCCAGG - Intergenic
1140371257 16:74414031-74414053 AAAATACAAAAAAATTAACCGGG - Intronic
1140395671 16:74624554-74624576 AAAATACAAGAAAATTAGCCGGG - Intronic
1140929437 16:79613540-79613562 AAAATACAAAAAAATTAACCGGG + Intergenic
1141082695 16:81066498-81066520 CAGTTACAAAAAAATTAGCCAGG - Intronic
1141550993 16:84806649-84806671 CGATTGCTAGAAAAATAATCAGG + Intergenic
1142075018 16:88112936-88112958 AAAATGCAAAAAAATTAGCCAGG - Intronic
1142300542 16:89255385-89255407 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1142321739 16:89387510-89387532 AAAATACAAAAAAATTAACCAGG + Intronic
1142326423 16:89418179-89418201 CAAGTCCAAGAAAACCAACCTGG + Intronic
1142357181 16:89606854-89606876 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1203120019 16_KI270728v1_random:1528580-1528602 AAACTACAAAAAAATTAACCGGG + Intergenic
1142661233 17:1430905-1430927 AAAATACAAAAAAATTAACCGGG + Intronic
1142814295 17:2413013-2413035 CAATTGCCAGAAAAACAGCCAGG - Intronic
1143063751 17:4225919-4225941 AAAATGCAAAAAAATTAGCCAGG - Intronic
1143122674 17:4618611-4618633 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1143193264 17:5056065-5056087 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1143246183 17:5487273-5487295 CAACAACAAGAAAATTAGCCAGG + Intronic
1143782256 17:9235121-9235143 CAAATACAAAAAAATTAGCCAGG - Intronic
1144045331 17:11450043-11450065 AAAATACAAAAAAATTAACCAGG - Intronic
1144491016 17:15709329-15709351 CAAATACAAAAAAATTAGCCGGG + Intronic
1144522684 17:15964446-15964468 AAAATACAAAAAAATTAACCAGG + Intronic
1144579773 17:16451903-16451925 AAAATGCAAAAAAATTAGCCGGG - Intronic
1144622365 17:16825595-16825617 AAAATACAAGAAAATTAGCCAGG + Intergenic
1144910390 17:18676859-18676881 CAAATACAAAAAAATTAGCCGGG - Intronic
1144930179 17:18852693-18852715 AAAATACAAGAAAATTAGCCAGG - Intronic
1145084621 17:19926960-19926982 AAAATGCAAAAAAATTAGCCAGG + Intronic
1145183954 17:20778259-20778281 GAATTGCAAAAAAATTAATTTGG - Intergenic
1145969207 17:28945973-28945995 AAAATACAAGAAAATTAGCCAGG + Intronic
1146327858 17:31902257-31902279 AAAATGCAAAAAAATTAACTGGG + Intergenic
1147110958 17:38261117-38261139 AAAATACAAAAAAATTAACCGGG - Intergenic
1147111496 17:38265223-38265245 GAAATGCAAAAAAATTAGCCGGG + Intergenic
1147204723 17:38828673-38828695 AAAATACAAAAAAATTAACCGGG - Intergenic
1147307321 17:39573192-39573214 AAAGTCCAAAAAAATTAACCGGG + Intergenic
1147522430 17:41187257-41187279 CAATAGCAAGGAAATAACCCAGG - Intergenic
1147711121 17:42465803-42465825 AAAATGCAAGAAAATTAGCTGGG + Intronic
1147714160 17:42492855-42492877 AAAATACAAGAAAATTAGCCAGG + Intronic
1147750412 17:42728579-42728601 AAAATACAAGAAAATTAGCCGGG + Intronic
1147779740 17:42932617-42932639 AAAATACAAAAAAATTAACCAGG + Intergenic
1148066126 17:44871497-44871519 AAAATGCAAAAAAATTAGCCAGG - Intronic
1148650131 17:49244519-49244541 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1148937403 17:51174607-51174629 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1149314782 17:55428718-55428740 AAAATACAAAAAAATTAACCAGG + Intergenic
1149343802 17:55714342-55714364 AAAATACAAGAAAATTAGCCGGG - Intergenic
1149542059 17:57474877-57474899 AAAATACAAGAAAATTAGCCAGG - Intronic
1149643055 17:58217381-58217403 CATTTGCTAGAAAATAACCCTGG + Intronic
1150048629 17:61937339-61937361 AAATTACAAAAAAATTAGCCAGG - Intergenic
1150064414 17:62096938-62096960 CAAATACAAAAAAATTAGCCGGG - Intergenic
1150504222 17:65681832-65681854 AAATTGCAAAAATATTAGCCAGG - Intronic
1150558154 17:66272257-66272279 AAAATACAAAAAAATTAACCAGG + Intergenic
1150642506 17:66959006-66959028 CAAATACAAAAAAGTTAACCAGG - Intergenic
1150689369 17:67351229-67351251 AAAATACAAAAAAATTAACCAGG + Intronic
1150839053 17:68591257-68591279 AAAATACAAAAAAATTAACCGGG - Intronic
1150889440 17:69130154-69130176 AAAATGCAAAAAAATTAGCCAGG + Intronic
1150910993 17:69387299-69387321 AAAATACAAAAAAATTAACCAGG + Intergenic
1151093252 17:71466572-71466594 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1151140076 17:71983141-71983163 AAAATCCAAAAAAATTAACCAGG - Intergenic
1151181232 17:72330189-72330211 AAATTACAAAAAAATTAGCCTGG + Intergenic
1151526653 17:74674233-74674255 CAACTGCCAAAAAATTAGCCAGG - Intronic
1151644931 17:75424023-75424045 CAAATACAAAAAAATTAGCCAGG + Intergenic
1151738857 17:75965175-75965197 AAAATACAAGAAAATTAGCCGGG + Intronic
1152159134 17:78656435-78656457 GAATTACAAAAAAATTAGCCGGG + Intergenic
1153160280 18:2197216-2197238 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1153366089 18:4257923-4257945 CGATTGCTAGAAAATGAACTGGG - Intronic
1153443728 18:5149703-5149725 CAGTTGCAAGAACATTGGCCAGG - Intronic
1153671669 18:7418118-7418140 CAATTGCAAGAAGATAAACTTGG - Intergenic
1153995469 18:10437348-10437370 CAAATGCAATTAAATTAAACAGG + Intergenic
1154073659 18:11178335-11178357 GAAATGCAAAAAAATTAGCCGGG - Intergenic
1154934071 18:21033034-21033056 AAATTAAAAGAAAATTAGCCAGG + Intronic
1155136808 18:23003894-23003916 AAAATACAAAAAAATTAACCGGG + Intronic
1155158106 18:23174630-23174652 AAAATGCAAAAAAATTAGCCGGG - Intronic
1155192588 18:23443818-23443840 AAATTACAAAAAAATTAGCCGGG - Intergenic
1155295474 18:24380789-24380811 TAAATGCAAAAAAATTAGCCAGG + Intronic
1155500220 18:26480268-26480290 GAGTTGAAACAAAATTAACCAGG - Intronic
1155781279 18:29839079-29839101 AAAATACAAAAAAATTAACCGGG + Intergenic
1155964765 18:32025502-32025524 AAAATACAAGAAAATTAGCCAGG + Intronic
1156028153 18:32680792-32680814 TAATATCAAGAATATTAACCAGG - Intronic
1156164782 18:34405095-34405117 CAATAGGAAGAAAAGTAACATGG + Intergenic
1156236699 18:35212324-35212346 AAAATACAAAAAAATTAACCGGG - Intergenic
1156329855 18:36110697-36110719 AAACTACAAAAAAATTAACCAGG - Intronic
1156570001 18:38242411-38242433 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1156606649 18:38674146-38674168 CAAGTCCAAGAAAAATAATCTGG + Intergenic
1156625644 18:38904551-38904573 CACTTGTAAGTCAATTAACCTGG + Intergenic
1157055690 18:44225910-44225932 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1157558724 18:48631303-48631325 AAAATACAAAAAAATTAACCGGG + Intronic
1157848244 18:51024137-51024159 AAATTACAAAAAAATTAGCCGGG - Intronic
1158173515 18:54626628-54626650 AAATTACAAAAAAATTAGCCAGG - Intergenic
1158501528 18:58006610-58006632 AAAATACAAAAAAATTAACCAGG + Intergenic
1158995347 18:62912778-62912800 GAAATACAAGAAAATTAGCCAGG - Intronic
1159461482 18:68726600-68726622 ATATTGCAAAAAAATTAGCCAGG - Intronic
1159663718 18:71131177-71131199 AAATTACAAAAAAATTAGCCGGG - Intergenic
1159667564 18:71180606-71180628 TTATTGCAAAAAAATTAGCCGGG + Intergenic
1159999449 18:75002642-75002664 AAAATACAAAAAAATTAACCGGG + Intronic
1161119777 19:2518954-2518976 AAATTACAAAAAAATTAGCCAGG - Intronic
1161161916 19:2766591-2766613 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161311881 19:3599488-3599510 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161358453 19:3832794-3832816 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161381780 19:3969297-3969319 AAAATGAAAAAAAATTAACCAGG - Intronic
1161430142 19:4226876-4226898 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1161617461 19:5279841-5279863 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161704615 19:5813511-5813533 AAAATACAAAAAAATTAACCAGG + Intergenic
1161706803 19:5825972-5825994 AAATTACAAAAAAATTAGCCGGG + Intronic
1161746833 19:6065484-6065506 CAAATACAAAAAAATTAGCCGGG + Intronic
1161838899 19:6666735-6666757 AAAATACAACAAAATTAACCGGG + Intronic
1162153367 19:8660796-8660818 AAAATACAAAAAAATTAACCAGG - Intergenic
1162200107 19:9013711-9013733 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1162276259 19:9657705-9657727 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162401096 19:10447057-10447079 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162436530 19:10663364-10663386 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162556903 19:11392682-11392704 AAAATGCAAAAAAATTAGCCGGG - Intronic
1162662313 19:12180024-12180046 AAATTACAAAAAAATTAGCCGGG - Intronic
1162665742 19:12210275-12210297 AAACTGCAAAAAAATTAGCCGGG - Intergenic
1162772828 19:12960081-12960103 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1162890227 19:13727372-13727394 AAATTACAAAAAAATTAGCCGGG + Intergenic
1162920509 19:13899307-13899329 AAAATACAAAAAAATTAACCAGG - Intronic
1163079222 19:14924909-14924931 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1163359821 19:16838830-16838852 AAAATGCAAAAAAATTAGCCAGG - Intronic
1163474433 19:17516743-17516765 AAAATACAAAAAAATTAACCAGG - Intronic
1163575371 19:18108130-18108152 AAAATACAAAAAAATTAACCAGG + Intronic
1163870396 19:19816516-19816538 CAAATACAAAAAAATTAGCCAGG - Intronic
1163983208 19:20921253-20921275 AAAATACAAAAAAATTAACCGGG + Intergenic
1164077589 19:21834596-21834618 AAAATACAAAAAAATTAACCAGG + Intronic
1164124887 19:22304197-22304219 CAAATACAAAAAAATTAGCCGGG - Intronic
1164269453 19:23658198-23658220 AAAATGCAAAAAAATTAGCCAGG + Intronic
1164950640 19:32333941-32333963 AAAATACAAAAAAATTAACCGGG + Intergenic
1165016334 19:32883017-32883039 AAAATACAAAAAAATTAACCAGG - Intronic
1165055330 19:33172929-33172951 CAAATACAAAAAAATTAGCCAGG + Intronic
1165133762 19:33650690-33650712 CAAAAGCAAAAAAATTAACCAGG - Intronic
1165292367 19:34897455-34897477 AAATTACAAAAAAATTAGCCAGG + Intergenic
1165684882 19:37811397-37811419 AAAATACAAAAAAATTAACCGGG - Intronic
1165799711 19:38541553-38541575 AAAATGCAAAAAAATTAGCCGGG + Intronic
1165929968 19:39351140-39351162 AAATTACAAAAAAATTAGCCAGG - Intronic
1166066501 19:40362594-40362616 CAAATGAAAGAAAATTAGCCTGG - Intronic
1166160638 19:40950273-40950295 AAAATACAAGAAAATTAGCCAGG - Intergenic
1166169535 19:41018011-41018033 AAACTACAAGAAAATTAGCCAGG - Exonic
1166291661 19:41867468-41867490 AAATTACAAGAAAATTAGCCAGG - Intronic
1166379546 19:42348758-42348780 AAAATGCAAAAAAATTAGCCAGG - Intronic
1166513634 19:43428979-43429001 AAATTACAAAAAAATTAGCCAGG + Intergenic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166594329 19:44031898-44031920 AAATTGCAAGTGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1166757883 19:45204890-45204912 AAAATACAAAAAAATTAACCAGG - Intronic
1166801388 19:45459725-45459747 AAAATACAAAAAAATTAACCGGG + Intronic
1166839758 19:45689874-45689896 AAAATGCAAACAAATTAACCAGG + Intronic
1166972139 19:46576167-46576189 TAAATACAAAAAAATTAACCAGG - Intronic
1167121420 19:47519562-47519584 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1167450821 19:49567830-49567852 AAAATGCAAAAAAATTAGCCGGG - Intronic
1167664120 19:50813370-50813392 AAATTACAAAAAAATTAGCCAGG - Intergenic
1167835871 19:52069231-52069253 AAACTACAAAAAAATTAACCGGG - Intronic
1167918184 19:52759507-52759529 AAAATACAAAAAAATTAACCGGG + Intergenic
1168173347 19:54605970-54605992 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168528622 19:57107506-57107528 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1168653942 19:58113153-58113175 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168708258 19:58481952-58481974 AAAATGCAAAAAAATTAGCCGGG - Intronic
1202685245 1_KI270712v1_random:43401-43423 AAAATGCAAAAAAATTAGCCGGG + Intergenic
925193479 2:1904527-1904549 AAAATGCAAAAAAATTAGCCAGG - Intronic
925234360 2:2265174-2265196 AAATTACAAAAAAATTAGCCAGG - Intronic
925255735 2:2485553-2485575 AAATTACAAAAAAATTAGCCGGG - Intergenic
925543443 2:4991280-4991302 AAAATACAAAAAAATTAACCAGG - Intergenic
925840044 2:7983011-7983033 CAACAGCAAGAAAAACAACCTGG + Intergenic
926277154 2:11412989-11413011 AAAATACAAAAAAATTAACCAGG + Intergenic
927343823 2:22013512-22013534 CAATTGAAAGAAACTTTATCAGG + Intergenic
927525281 2:23734315-23734337 AAAATGCAAAAAAATTAGCCAGG - Intergenic
927566816 2:24120711-24120733 AAAATACAAGAAAATTAGCCAGG - Intronic
927631658 2:24779603-24779625 AAAATACAAAAAAATTAACCGGG + Intergenic
927968425 2:27287361-27287383 AAATTACAAAAAAATTAGCCAGG - Intronic
928056232 2:28057981-28058003 AAAATGCAAAAAAATTAACCGGG + Intronic
928380065 2:30810027-30810049 TAATTGCAAGAGAAATAATCTGG - Intronic
928419202 2:31124410-31124432 CAATTGCATTTAAATTTACCAGG + Intronic
928670263 2:33596729-33596751 AAAATACAAAAAAATTAACCAGG + Intronic
928948771 2:36795571-36795593 AAAATACAAGAAAATTAGCCGGG - Intronic
928960735 2:36923288-36923310 AAAATGCAAAAAAATTAGCCAGG + Intronic
928977904 2:37107983-37108005 TAAATACAAAAAAATTAACCAGG + Intronic
929219336 2:39447392-39447414 AAATTTAAAAAAAATTAACCAGG + Intergenic
929258726 2:39841266-39841288 AAAATGCAAAAAAATTAGCCGGG - Intergenic
929709410 2:44251025-44251047 CAAATACAAAAAAATTAGCCAGG - Intergenic
930004958 2:46889317-46889339 AAAATGCAAAAAAATTAGCCGGG + Intergenic
930083361 2:47473152-47473174 TAATTAAAAAAAAATTAACCAGG - Intronic
930101343 2:47605827-47605849 AAAATACAAAAAAATTAACCAGG + Intergenic
930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG + Intronic
930445652 2:51468317-51468339 AAAATGCAAAAAAATTAGCCGGG - Intergenic
930449290 2:51514292-51514314 AAAATGCAAAAAAATTAGCCAGG - Intergenic
930483989 2:51988880-51988902 AAATTACAAAAAAATTAGCCAGG - Intergenic
930538983 2:52680841-52680863 AAAATGCAAAAAAATTAGCCAGG - Intergenic
931266970 2:60669243-60669265 AAAATGCAAAAAAATTAGCCAGG + Intergenic
931267220 2:60671227-60671249 AAATTACAAAAAAATTAGCCGGG - Intergenic
931271562 2:60708250-60708272 AAACTACAAAAAAATTAACCAGG + Intergenic
931727748 2:65127892-65127914 AAAATGCAAAAAAATTAGCCGGG - Intronic
932038178 2:68269846-68269868 AAAATACAAAAAAATTAACCAGG - Intergenic
932507467 2:72249413-72249435 AAAATACAAGAAAATTAGCCGGG - Intronic
932546825 2:72720590-72720612 AAATTACAAAAAAATTAGCCAGG + Intronic
932739492 2:74280843-74280865 AAAATACAAAAAAATTAACCAGG - Intronic
933426224 2:82115235-82115257 CAATTTCTAGAATATTCACCTGG - Intergenic
933493030 2:83012517-83012539 AAAATACAAAAAAATTAACCAGG + Intergenic
933664916 2:84957188-84957210 AAAATACAAAAAAATTAACCTGG - Intergenic
933680531 2:85095845-85095867 AAAATGCAAAAAAATTAGCCAGG - Intergenic
933747358 2:85580825-85580847 AAAATACAAGAAAATTAGCCGGG - Intronic
934067912 2:88356332-88356354 AAAATACAAAAAAATTAACCGGG + Intergenic
934498676 2:94834924-94834946 CAAAAGCAGAAAAATTAACCAGG - Intergenic
934638639 2:96012592-96012614 AAAATGCAAAAAAATTAGCCAGG - Intergenic
934795011 2:97092810-97092832 AAAATGCAAAAAAATTAGCCAGG + Intronic
934991287 2:98923460-98923482 AAATTGCAAGCAAAGTACCCAGG + Intronic
935073190 2:99713857-99713879 AAAATACAAGAAAATTAGCCGGG - Intronic
935246333 2:101221655-101221677 AAATTACAAAAAAATTAGCCGGG - Intronic
935468296 2:103425856-103425878 AAATTACAAAAAAATTAGCCGGG + Intergenic
935686485 2:105688302-105688324 AAAATGCAAAAAAATTAACCGGG - Intergenic
936395929 2:112129911-112129933 AAATTACAAAAAAATTAGCCGGG + Intergenic
936407467 2:112219550-112219572 CAATTACATGGAAGTTAACCTGG - Intronic
936504160 2:113091720-113091742 GAAATGTGAGAAAATTAACCAGG - Intergenic
936706712 2:115083988-115084010 CACCTGAAAGAAAACTAACCTGG - Intronic
937215183 2:120308213-120308235 AAAATGCAAAAAAATTAGCCAGG + Intergenic
937397463 2:121549843-121549865 AAAATGCAAAAAAATTAGCCAGG + Intronic
938012104 2:127837120-127837142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
938174373 2:129110877-129110899 AAAATGCAAAAAAATTAGCCGGG + Intergenic
938247059 2:129785902-129785924 CAAATACAAAAAAATTAGCCGGG - Intergenic
938284215 2:130095186-130095208 AAAATACAAAAAAATTAACCGGG - Intronic
938334857 2:130483753-130483775 AAAATACAAAAAAATTAACCGGG - Intronic
938354964 2:130636916-130636938 AAAATACAAAAAAATTAACCGGG + Intronic
938414332 2:131091981-131092003 CAAATACAAAAAAATTAGCCAGG + Intronic
938431392 2:131243705-131243727 AAAATACAAAAAAATTAACCGGG + Intronic
939036527 2:137138045-137138067 CTATTTTAAAAAAATTAACCAGG - Intronic
939111677 2:138015942-138015964 CAATTGCACTAAAATTAAGCAGG - Exonic
939380627 2:141430974-141430996 AAATTAAAAGAAAATTAGCCAGG + Intronic
939843748 2:147219760-147219782 AAATTACAAAAAAATTAGCCAGG + Intergenic
940671787 2:156678962-156678984 CAATACCAAAAAAATTAGCCGGG + Intergenic
941030475 2:160505559-160505581 TAATGGCATGAAAATTAAACAGG - Intergenic
941425394 2:165338418-165338440 AAAATGCAACAAAATTAGCCAGG - Intronic
941555537 2:166975763-166975785 AAAATGCAAAAAAATTAGCCGGG + Intronic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
941785654 2:169495814-169495836 AAATTACAAAAAAATTAGCCAGG - Intronic
941818870 2:169825498-169825520 AAATTACAAAAAAATTAGCCGGG + Intergenic
941926733 2:170903012-170903034 CAATTTTAAAAAAATTAGCCAGG - Intergenic
942560978 2:177218220-177218242 AAAATGCAAAAAAATTAACCGGG - Intronic
942907392 2:181200274-181200296 AAAATGCAAAAAAATTAGCCAGG + Intergenic
942980715 2:182078018-182078040 AAAATGCAAAAAAATTAGCCGGG + Intronic
942993966 2:182238106-182238128 AAAATGCAAAAAAATTAGCCAGG + Intronic
943267963 2:185761534-185761556 CTATTCCAATAAAATTATCCTGG + Intronic
943563330 2:189489291-189489313 CAATTTTTACAAAATTAACCAGG - Intergenic
943769449 2:191700619-191700641 AAATTGCAAGGAAATTAAACGGG + Intergenic
943893503 2:193322179-193322201 AAAGTACAAAAAAATTAACCAGG - Intergenic
943948761 2:194102212-194102234 AAAATACAAGAAAATTAGCCAGG + Intergenic
944234689 2:197431276-197431298 AAAGTACAAAAAAATTAACCGGG - Intronic
944314511 2:198270448-198270470 AAAATACAAAAAAATTAACCAGG - Intronic
944383856 2:199142215-199142237 CAATGAGAAGAAAAATAACCTGG - Intergenic
944552323 2:200855846-200855868 CAAAAATAAGAAAATTAACCGGG + Intronic
945086065 2:206133817-206133839 AAAATACAAAAAAATTAACCAGG + Intronic
945197404 2:207250207-207250229 CACTTGCAACAAAATTACACGGG + Intergenic
945237229 2:207642505-207642527 AAAATACAAAAAAATTAACCAGG + Intergenic
945341470 2:208661540-208661562 CAACTGGAAGAAAATGAACAAGG - Intronic
945396722 2:209327110-209327132 CAAATACAAAAAAATTAGCCAGG + Intergenic
945398208 2:209347680-209347702 AAAATACAAAAAAATTAACCGGG - Intergenic
945722762 2:213439007-213439029 CAGCTGCAAGAAAATTAATTTGG + Intronic
945738767 2:213635193-213635215 CAAATACAAAAAAATTAGCCAGG - Intronic
945905992 2:215593972-215593994 AAAATACAAAAAAATTAACCAGG + Intergenic
946262875 2:218510832-218510854 AAAATGCAAGAAAATTAGCCAGG + Intronic
946283711 2:218686097-218686119 AAAATACAAAAAAATTAACCGGG - Intronic
946380109 2:219342022-219342044 AAAATGCAAAAAAATTAGCCGGG + Intergenic
946579854 2:221116634-221116656 CAATTGAAAAATAATTAATCTGG + Intergenic
946766544 2:223045999-223046021 AAAATGCAAAAAAATTAGCCAGG - Intergenic
946825261 2:223671475-223671497 AAATTGCCATAAAATTAACTAGG + Intergenic
946965216 2:225029983-225030005 AAAATACAAAAAAATTAACCAGG + Intronic
947644938 2:231731685-231731707 AAATTACAAAAAAATTAGCCAGG + Intergenic
947686252 2:232088238-232088260 AAAATGCAAAAAAATTAGCCAGG + Intronic
947963447 2:234259260-234259282 AAAATACAAAAAAATTAACCAGG + Intergenic
948142292 2:235682501-235682523 AAATTAAAAAAAAATTAACCAGG - Intronic
948314240 2:237014977-237014999 AAATAGAAAGAAAATTAGCCGGG - Intergenic
948448089 2:238049271-238049293 AAAATACAAAAAAATTAACCGGG + Intronic
948503672 2:238412959-238412981 AAAATACAAAAAAATTAACCAGG - Intergenic
1168834522 20:869276-869298 AAATGGGAAGAAAACTAACCTGG + Intergenic
1168973365 20:1946092-1946114 AAATTTAAAAAAAATTAACCAGG - Intergenic
1169032298 20:2418914-2418936 AAAATACAAGAAAATTAGCCGGG + Intronic
1169228210 20:3869331-3869353 AAAGTGCAAAAAAATTAGCCAGG - Exonic
1169367835 20:5005463-5005485 AAATTTCAATCAAATTAACCAGG - Intronic
1169449445 20:5699084-5699106 AAAATACAAAAAAATTAACCAGG + Intergenic
1169470267 20:5879023-5879045 CAATTAAAAGAAAATTAGCTGGG - Intergenic
1169807332 20:9572926-9572948 AATTTGCAAGACAATTGACCTGG - Intronic
1169832791 20:9842296-9842318 CAAATACAAAAAAATTAGCCGGG + Intergenic
1170169107 20:13391805-13391827 AAAATGCAAAAAAATTAGCCAGG + Intronic
1170688985 20:18595098-18595120 CCATGGCAAGAAAGTTGACCAGG - Intronic
1170812104 20:19682092-19682114 AAAATACAACAAAATTAACCAGG + Intronic
1170869907 20:20195918-20195940 GAATTACAAAAAAATTAGCCAGG + Intronic
1170874059 20:20234385-20234407 CAACTTCAAGAATATTAACAAGG - Intronic
1171479788 20:25445505-25445527 AAAATGCAAAAAAATTAGCCAGG - Intronic
1171980318 20:31623516-31623538 AAAATACAAAAAAATTAACCGGG - Intergenic
1172014926 20:31867803-31867825 AAAATGCAAAAAAATTAGCCGGG - Intronic
1172333279 20:34091555-34091577 CAAATACAAAAAAATTAGCCAGG + Intronic
1172341715 20:34163070-34163092 AAAATGCAACAAAATTAGCCGGG - Intergenic
1172351285 20:34243902-34243924 AAAATACAAAAAAATTAACCGGG + Intronic
1173206049 20:40994273-40994295 AAATTGAAGGAAAATTAGCCAGG + Intergenic
1173996524 20:47342685-47342707 CAAATACAAAAAAATTAGCCGGG + Intronic
1174003048 20:47388745-47388767 AAAATACAAAAAAATTAACCGGG + Intergenic
1174319748 20:49731992-49732014 AAAATGCAAAAAAATTACCCGGG + Intergenic
1174363401 20:50042284-50042306 AAACAGCACGAAAATTAACCTGG + Intergenic
1174384178 20:50176928-50176950 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1174827340 20:53780435-53780457 CAAATACAAAAAAATTAGCCGGG - Intergenic
1174828394 20:53790408-53790430 AAAATACAAAAAAATTAACCAGG - Intergenic
1175347559 20:58291992-58292014 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1176134629 20:63516752-63516774 AAATTACAAAAAAATTAGCCGGG - Intergenic
1176518258 21:7803258-7803280 AAAATACAAAAAAATTAACCAGG + Intergenic
1176701958 21:10064338-10064360 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1176702492 21:10072432-10072454 CAATTGAAAAAAAAATAGCCAGG - Intergenic
1177055978 21:16301286-16301308 CAAATGTACAAAAATTAACCTGG + Intergenic
1177329767 21:19642880-19642902 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177350832 21:19939134-19939156 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177407110 21:20683947-20683969 AAAATACAAGAAAATTAGCCGGG + Intergenic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1177888345 21:26774055-26774077 CAAATACAAAAAAATTAGCCAGG - Intergenic
1178278359 21:31259294-31259316 AAATTTCAAAAAAATTAGCCAGG - Intronic
1178296332 21:31413428-31413450 CAAATACAAAAAAATTAGCCGGG - Intronic
1178328253 21:31662852-31662874 AAAATGCAAAAAAATTAGCCGGG + Intronic
1178620469 21:34169670-34169692 AAAATACAAAAAAATTAACCAGG - Intergenic
1178652286 21:34433271-34433293 AAAATACAAAAAAATTAACCAGG + Intergenic
1178845002 21:36167331-36167353 CAAATACAAAAAAATTAGCCAGG - Intronic
1178869878 21:36364521-36364543 CAAATACAAAAAAATTAACCAGG + Intronic
1179556966 21:42185245-42185267 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1179648363 21:42789978-42790000 AAAATACAAGAAAATTAGCCGGG + Intergenic
1180250937 21:46587675-46587697 AAAATACAAAAAAATTAACCAGG + Intergenic
1180315694 22:11276092-11276114 AAAATACAAAAAAATTAACCAGG - Intergenic
1180628757 22:17212430-17212452 CAAATACAAAAAAATTAGCCGGG - Intronic
1180903312 22:19390432-19390454 AAATTACAAAAAAATTAACCGGG + Intronic
1181077472 22:20391076-20391098 AAATTACAAAAAAATTAGCCGGG + Intergenic
1181093830 22:20492748-20492770 AAAATGCAAGAAAATTAGCTGGG - Intronic
1181371800 22:22424882-22424904 CAATTCCAAGAAAAAAAATCTGG - Intergenic
1181396129 22:22623775-22623797 CAAATACAAAAAAATTATCCAGG - Intergenic
1181602333 22:23960022-23960044 AAATGGAAAAAAAATTAACCGGG - Intronic
1181659315 22:24330712-24330734 CAATCTAAAGAAAATTAACAGGG - Intronic
1181682426 22:24504886-24504908 AAAATTCAAGAAAATTAGCCAGG - Intronic
1181751773 22:24993918-24993940 CAAATACAAAAAAATTAGCCGGG + Intronic
1181825106 22:25508700-25508722 AAAATACAAAAAAATTAACCTGG - Intergenic
1181850545 22:25746959-25746981 AAAATGCAAAAAAATTAGCCAGG + Intronic
1182055090 22:27346479-27346501 AAAATACAAAAAAATTAACCGGG - Intergenic
1182485869 22:30638339-30638361 AAAATACAAAAAAATTAACCGGG + Intronic
1182694612 22:32188364-32188386 GCATTGCAAAAAGATTAACCAGG + Intergenic
1182716745 22:32363073-32363095 GCATTGCAAAAAGATTAACCAGG - Intronic
1182745833 22:32604843-32604865 AAAATGCAAAAAAATTAGCCGGG + Intronic
1182939840 22:34265042-34265064 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1183042987 22:35197371-35197393 GAACTCCAAGAAAATAAACCTGG + Intergenic
1183630774 22:39031407-39031429 AAATTACAAAAAAATTAGCCGGG + Intronic
1183652137 22:39162914-39162936 AAAATACAAAAAAATTAACCAGG - Intergenic
1183765226 22:39867061-39867083 AAAATGCAAAAAAATTAGCCGGG - Intronic
1183848881 22:40566378-40566400 AAAATGCAAAAAAATTAGCCAGG - Intronic
1183864797 22:40695582-40695604 AAAATGAAAGAAAATTAGCCGGG - Intergenic
1183939268 22:41283940-41283962 AAATTGCATAAAAATTAACCAGG + Intronic
1183959841 22:41404820-41404842 CAATAACAAAAAAATTAGCCAGG + Intergenic
1183999113 22:41659368-41659390 AAAATACAAAAAAATTAACCGGG - Intronic
1184146080 22:42611714-42611736 AAAATACAAAAAAATTAACCAGG + Intronic
1184287753 22:43481597-43481619 CAATCGCAGGAGAATAAACCTGG - Intronic
1184360291 22:44013055-44013077 AAACTACAAAAAAATTAACCGGG - Intronic
1184584600 22:45439249-45439271 CAAATACAAAAAAATTAGCCGGG + Intergenic
1184701532 22:46177048-46177070 CAAATACAAAAAAATTAGCCGGG + Intronic
1184761344 22:46546532-46546554 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1184809610 22:46822465-46822487 CTATTGCAAGAAAAACAAACAGG - Intronic
1184883000 22:47323432-47323454 AAAATACAAGAAAATTAGCCAGG + Intergenic
949422715 3:3883133-3883155 AAATTGCAAGAAAACTATCATGG + Intronic
949661309 3:6282352-6282374 CAAATGTAAGAAAATTAATTAGG - Intergenic
949773476 3:7604569-7604591 CCTTTGCAAGAAAACTGACCAGG - Intronic
949784728 3:7728413-7728435 CAGTTACAACAAAATTAATCAGG - Intronic
949927407 3:9052558-9052580 CAAATGAAAGATAATTAACATGG + Intronic
949964713 3:9345623-9345645 AAAATGCAAAAAAATTAGCCGGG + Intronic
950280549 3:11704220-11704242 CAAATACAAAAAAATTAGCCGGG + Intronic
950469542 3:13175928-13175950 AAATTGCAAGCTAATTACCCAGG - Intergenic
950783410 3:15411921-15411943 AAAATACAAAAAAATTAACCAGG - Intronic
950992489 3:17454618-17454640 AAAATACAAAAAAATTAACCAGG - Intronic
950992555 3:17455677-17455699 AAATTACAAAAAAATTAACCAGG + Intronic
951051209 3:18096339-18096361 AAAATACAAAAAAATTAACCGGG - Intronic
951114743 3:18846400-18846422 AAAATACAAAAAAATTAACCAGG + Intergenic
951140569 3:19153790-19153812 AAAATGCAAAAAAATTAGCCAGG - Intronic
951879231 3:27464023-27464045 CAAAAACACGAAAATTAACCAGG + Intronic
951961440 3:28327079-28327101 CAATTGAAAGATATTTAACTAGG + Intronic
952034017 3:29178010-29178032 AAAATGCAAAAAAATTAGCCAGG - Intergenic
952075915 3:29697423-29697445 CAATGGAAAGAAAAGTAAACCGG - Intronic
952339697 3:32435241-32435263 CAAATACAAAAAAATTAGCCGGG + Intronic
952373671 3:32747255-32747277 AAAATGCAAAAAAATTAAGCGGG + Intronic
952450927 3:33432161-33432183 AAATAGCAAAAAAATTAGCCAGG + Intronic
952452548 3:33445749-33445771 AAAATACAAAAAAATTAACCAGG - Intergenic
952934345 3:38383993-38384015 CAAATGCAGGAAAAGTAACCTGG - Intronic
953600077 3:44354112-44354134 CACATGCGAAAAAATTAACCTGG - Intronic
953710983 3:45270697-45270719 CAAATACAAAAAAATTAGCCAGG + Intergenic
953756058 3:45646818-45646840 TAATTTCAAAAAAATTAGCCAGG - Intronic
954194372 3:48987710-48987732 CAAATACAAAAAAATTAGCCGGG + Intergenic
954560031 3:51548982-51549004 CAAATACAAAAAAATTAGCCGGG - Intronic
954735096 3:52700902-52700924 AAACTGCAAAAAAATTAGCCAGG + Intronic
954741532 3:52754911-52754933 AAAATGCAAAAAAATTAGCCGGG + Intronic
955194354 3:56791250-56791272 CAATTGAAAGAAAATTAGCCAGG + Intronic
955277386 3:57559058-57559080 CAAATACAAAAAAATTAGCCGGG + Intronic
955296840 3:57743399-57743421 CAAATACAAAAAAATTAGCCAGG + Intergenic
955327120 3:58017409-58017431 AAAATGCAAAAAAATTATCCAGG - Intronic
955487385 3:59448435-59448457 AAAATACAAGAAAATTAGCCAGG - Intergenic
955682862 3:61520168-61520190 AAAATACAAGAAAATTAGCCGGG - Intergenic
955946335 3:64198049-64198071 AAAATACAAGAAAATTAGCCAGG + Intronic
956120008 3:65956839-65956861 AAAATGCAAAAAAATTAGCCTGG + Intronic
956187370 3:66575440-66575462 AAATTACAAAAAAATTAGCCGGG + Intergenic
956301659 3:67779157-67779179 CAATGAGAAGAAAATTAACAAGG - Intergenic
956347386 3:68295765-68295787 AAATAGAAAGAAAATTAGCCAGG - Intronic
956934549 3:74085183-74085205 AAAATACAAGAAAATTAGCCAGG - Intergenic
956994836 3:74813732-74813754 TAATTTAAAGAAAATTAACCTGG + Intergenic
957246352 3:77721679-77721701 AAAATGCAAAAAAATTAGCCAGG - Intergenic
957388262 3:79526085-79526107 CAAATGCCAGAAACTTAAACAGG + Intronic
957462424 3:80538630-80538652 AAAATACAAAAAAATTAACCAGG + Intergenic
957514237 3:81230576-81230598 AAATTACAAAAAAATTAGCCGGG - Intergenic
957535918 3:81503425-81503447 CAATAAAAAAAAAATTAACCCGG + Intronic
957805780 3:85147112-85147134 AAAATACAAGAAAATTAGCCGGG + Intronic
957859752 3:85931276-85931298 CAAGAGAAAGAAAATTAGCCAGG + Intronic
958139351 3:89541141-89541163 AAAATGCAAAAAAATTAGCCGGG - Intergenic
958568962 3:95855200-95855222 AAAATACAAAAAAATTAACCAGG + Intergenic
958647622 3:96892379-96892401 AAAGTACAAAAAAATTAACCAGG - Intronic
958801976 3:98766579-98766601 AAAATGCAAAAAAATTAGCCGGG - Intronic
958947941 3:100385135-100385157 GAATTGCAAGAAATTTAATTCGG - Intronic
959573915 3:107913395-107913417 AAAATACAAAAAAATTAACCGGG - Intergenic
959676480 3:109041550-109041572 AAAATGCAAAAAAATTAGCCCGG + Intronic
960028670 3:113036092-113036114 AAAATGCAAAAAAATTAGCCAGG + Intergenic
960093483 3:113665665-113665687 AAATTACAAAAAAATTAGCCAGG + Intronic
960095110 3:113681877-113681899 AAAATGCAAAAAAATTAGCCAGG - Intronic
960164858 3:114389726-114389748 AAAATGCAAAAAAATTAGCCAGG + Intronic
960867536 3:122217257-122217279 AAACTACAAAAAAATTAACCGGG - Intronic
961263934 3:125625073-125625095 AAAATACAAAAAAATTAACCAGG + Intergenic
961268155 3:125664660-125664682 AAATTTCAAAAAAATTAGCCAGG - Intergenic
962516097 3:136153627-136153649 AAAATACAAAAAAATTAACCGGG + Intronic
962519244 3:136183132-136183154 CAATAGCTGGAAAATTAACCAGG + Intronic
963012791 3:140789225-140789247 AAATTACAAAAAAATTAGCCAGG + Intergenic
963204653 3:142620283-142620305 CAAATACAAAAAAATTAGCCAGG - Intronic
963616567 3:147546753-147546775 AAAATACAAAAAAATTAACCAGG + Intergenic
963638593 3:147831018-147831040 AAAATACAAGAAAATTAGCCGGG - Intergenic
963747457 3:149139506-149139528 CAATTTAGAGAAAATTAACTTGG + Intronic
963883430 3:150553567-150553589 CAAATACAAAAAAATTAGCCAGG - Intronic
964742637 3:159983574-159983596 AAAATACAAGAAAATTAGCCAGG + Intergenic
964798278 3:160523688-160523710 AAAATGCAAAAAAATTAGCCAGG + Intronic
965470124 3:169080294-169080316 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965593233 3:170381919-170381941 AAAATGCAAAAAAATTAGCCGGG + Intronic
965705322 3:171500667-171500689 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965897768 3:173598489-173598511 CATTCACAAGAAAATTAAACCGG - Intronic
965905185 3:173696705-173696727 CAATTGAAAGAACATTAGTCGGG + Intronic
966035771 3:175413047-175413069 AAAATACAAAAAAATTAACCGGG - Intronic
966181123 3:177189492-177189514 AAATTACAAAAAAATTAGCCAGG + Intronic
966202132 3:177368383-177368405 AAATTACAAAAAAATTAACCGGG - Intergenic
966274011 3:178142594-178142616 AAACTACAAAAAAATTAACCAGG + Intergenic
966386668 3:179406771-179406793 AAAATGCAAAAAAATTAGCCAGG - Intronic
966425694 3:179777611-179777633 CAAATACAAAAAAATTAGCCAGG - Intronic
966425808 3:179778603-179778625 AAAATGCAAAAAAATTAGCCGGG + Intronic
966610754 3:181865964-181865986 AAAATGCAAGAAAATTAGCCGGG - Intergenic
966795072 3:183705877-183705899 AAAATGCAAAAAAATTAGCCAGG + Intronic
966824046 3:183948860-183948882 AAATTACAAAAAAATTAACCAGG - Intronic
967030458 3:185601483-185601505 CCAGTGTATGAAAATTAACCAGG - Intronic
967165216 3:186773993-186774015 AAATAGCAAAAAAATTAGCCGGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967402140 3:189075291-189075313 AAAATACAAGAAAATTAGCCGGG - Intronic
967585129 3:191204046-191204068 CAAATACAAAAAAATTAGCCAGG - Intronic
967597707 3:191347150-191347172 TTATTGCAGGATAATTAACCCGG + Intronic
967637683 3:191823026-191823048 CAATTACAGCAAAATTAAACAGG + Intergenic
967689186 3:192454197-192454219 AAAATACAAAAAAATTAACCAGG - Intronic
967753434 3:193141199-193141221 AAAATGCAAAAAAATTAGCCGGG + Intergenic
967798356 3:193624480-193624502 CAAATGAAAGAAAATAAATCAGG + Intronic
967838667 3:193985880-193985902 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967870106 3:194222766-194222788 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967892754 3:194374850-194374872 AAAATACAAAAAAATTAACCAGG - Intergenic
967900662 3:194448236-194448258 AAATTACAAAAAAATTAGCCGGG - Intronic
968108219 3:196018754-196018776 CAACTGCAAGAAATTTCACTTGG - Intergenic
968249470 3:197193978-197194000 AAAATACAAAAAAATTAACCAGG - Intronic
968326102 3:197817979-197818001 AAAATACAAAAAAATTAACCAGG - Intronic
968332569 3:197884313-197884335 AAAATACAAGAAAATTAGCCAGG - Intronic
968414128 4:414799-414821 CCATTGTAAGAAAAATAAACTGG - Intergenic
968836802 4:2970828-2970850 AAAATGCAAAAAAATTAGCCAGG - Intronic
969031746 4:4221260-4221282 CAATTTTAAGAAAATGAGCCAGG + Intronic
969385367 4:6842744-6842766 AAAATGCAAAAAAATTAGCCAGG - Intronic
969811402 4:9651291-9651313 AAAATACAAAAAAATTAACCGGG - Intergenic
969943671 4:10761023-10761045 AAATTTTAGGAAAATTAACCTGG + Intergenic
969946542 4:10789028-10789050 AAATTACAAAAAAATTAGCCAGG + Intergenic
970276800 4:14409483-14409505 AAAATACAAAAAAATTAACCGGG + Intergenic
970366177 4:15360351-15360373 CAATTGCCAAAAATATAACCAGG - Intronic
970462289 4:16286899-16286921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
970465548 4:16319104-16319126 AAAATGCAAAAAAATTAGCCAGG - Intergenic
970497865 4:16645374-16645396 AAAATGCAAAAAAATTAGCCGGG + Intronic
970887989 4:21008682-21008704 AAAATGCAAAAAAATTAGCCGGG - Intronic
971422337 4:26485031-26485053 AAAATGCAAAAAAATTAGCCGGG + Intronic
971596278 4:28533374-28533396 CAAATACAAAAAAATTAGCCGGG - Intergenic
971842276 4:31868900-31868922 GAAATACAAAAAAATTAACCTGG - Intergenic
972061826 4:34883807-34883829 AAAATGCAAAAAAATTAGCCAGG - Intergenic
972344538 4:38182120-38182142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
972424696 4:38921416-38921438 AAATTTTAAGAAAATTAGCCAGG - Intronic
972450897 4:39197263-39197285 AAAATACAAAAAAATTAACCAGG + Intronic
972487170 4:39553219-39553241 AAAATACAAAAAAATTAACCAGG - Intronic
972507267 4:39731519-39731541 CAAATACAAAAAAATTAGCCAGG + Intronic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
972608806 4:40638189-40638211 CAAATACAAAAAAATTAGCCAGG + Intergenic
972761107 4:42105343-42105365 CAAAAGGAAAAAAATTAACCAGG + Intergenic
972910872 4:43814859-43814881 ACATTGCAAAAAAATCAACCAGG - Intergenic
972953467 4:44358727-44358749 AAAATACAAAAAAATTAACCGGG - Intronic
973201239 4:47504721-47504743 AAAATGCAAAAAAATTAGCCAGG - Intronic
973236152 4:47908261-47908283 AAATTCTAAAAAAATTAACCAGG + Intronic
973268600 4:48236440-48236462 AAAATACAAAAAAATTAACCGGG - Intronic
973320907 4:48809361-48809383 CAAATACAAAAAAATTAACTGGG + Intronic
974777783 4:66509344-66509366 TAATTTCTAGAAAATTAACAAGG - Intergenic
975131580 4:70837794-70837816 AAAATGCAAAAAAATTAGCCGGG - Intronic
975145114 4:70958323-70958345 AAAATGCAAAAAAATTAGCCAGG - Intronic
975159318 4:71107505-71107527 AAAATGCAAAAAAATTAGCCGGG - Intergenic
975347699 4:73312457-73312479 AAATTCAAAAAAAATTAACCGGG + Intergenic
975564805 4:75743143-75743165 AAAATACAAGAAAATTAGCCAGG - Intronic
975585539 4:75944622-75944644 AAAATGCAAAAAAATTAGCCAGG - Intronic
976169661 4:82290054-82290076 AAAATGCAAAAAAATTAGCCGGG + Intergenic
976234602 4:82882957-82882979 AAAATACAAGAAAATTAGCCAGG + Intronic
976294928 4:83460743-83460765 CAAATACAAAAAAATTATCCGGG + Exonic
976371056 4:84288523-84288545 CAATTGACAGAAAATTAACAAGG + Intergenic
976866834 4:89738632-89738654 AAATTACAAAAAAATTAGCCAGG - Intronic
977372259 4:96153748-96153770 AAATTTTAAGAAAATCAACCAGG + Intergenic
977578040 4:98695555-98695577 AAAATACAAAAAAATTAACCGGG + Intergenic
977760912 4:100735879-100735901 CAAATGGAAGAAAATTTAGCAGG + Intronic
977825743 4:101529677-101529699 AAAATACAAGAAAATTAGCCAGG + Intronic
977902410 4:102437586-102437608 GAAATACAAGAAAATTAGCCAGG + Intergenic
978428200 4:108604289-108604311 AAAATACAAAAAAATTAACCAGG - Intergenic
978454334 4:108871474-108871496 AAAATGCAAAAAAATTAGCCGGG - Intronic
978481196 4:109192691-109192713 AAATTACAAAAAAATTAGCCAGG + Intronic
978741035 4:112138227-112138249 AAAATGCAAAAAAATTAGCCGGG - Intergenic
978842504 4:113231210-113231232 AAAATACAAAAAAATTAACCAGG - Intronic
978853866 4:113370597-113370619 CAAATACAAAAAAATTAGCCAGG + Intronic
978866584 4:113520245-113520267 AAAATACAAAAAAATTAACCGGG + Intronic
978878625 4:113673355-113673377 CAATTGCAAGAAAATTCTCATGG + Intronic
978928892 4:114287135-114287157 CAGTCCCAAGAAAATGAACCAGG - Intergenic
979165778 4:117528500-117528522 AAAATACAAAAAAATTAACCTGG - Intergenic
979484761 4:121257732-121257754 AAAATGCAAAAAAATTAGCCAGG + Intergenic
979628777 4:122877268-122877290 AAAATACAAAAAAATTAACCAGG - Intronic
979683949 4:123490352-123490374 AAAATGCAAAAAAATTAGCCAGG - Intergenic
979859115 4:125671755-125671777 AAATTACAAAAAAATTAGCCGGG - Intergenic
979998027 4:127456194-127456216 CAATTGTAAGAAATTTAAAAGGG + Intergenic
980148500 4:129019184-129019206 TAATACCAAGAAAATTACCCAGG + Intronic
980229751 4:130034032-130034054 AAATTACAAAAAAATTAGCCGGG - Intergenic
980260847 4:130445308-130445330 AAAATGCAAAAAAATTAGCCAGG - Intergenic
980402638 4:132312262-132312284 CAATTTGAAGAAAAATAAACTGG + Intergenic
980857982 4:138463582-138463604 CAATTGCAAGTACATGAAACAGG - Intergenic
981127244 4:141120787-141120809 CAATGGCAAGAACTTTAACTTGG + Intronic
982150125 4:152444982-152445004 AAAATACAAGAAAATTAGCCAGG - Intronic
982329906 4:154169772-154169794 AAAATACAAGAAAATTAGCCGGG - Intergenic
982898763 4:160970976-160970998 AAAATGCAAAAAAATTAGCCAGG + Intergenic
983193786 4:164782537-164782559 AAAATACAAGAAAATTAGCCGGG - Intergenic
983282935 4:165704287-165704309 AAAATACAAAAAAATTAACCGGG - Intergenic
983422417 4:167536141-167536163 CAAATACAAGAAAATTAGCCAGG - Intergenic
983457236 4:167980452-167980474 CAAATACAAAAAAATTAGCCAGG + Intergenic
983775997 4:171608630-171608652 AAATTGCAAGAAAATTAATATGG + Intergenic
984156489 4:176201341-176201363 AAATTGAAAAAAAGTTAACCAGG + Intergenic
984236771 4:177168815-177168837 AAAATGCAAAAAAATTAGCCAGG - Intergenic
984701838 4:182823344-182823366 AAATTTCAAAAAAATTAGCCAGG - Intergenic
984807752 4:183767001-183767023 CAAATACAAAAAAATTAGCCGGG + Intergenic
985282585 4:188301685-188301707 AAAATGCAAAAAAATTAGCCGGG - Intergenic
985694924 5:1334863-1334885 CAATTTCCAGACAATCAACCAGG + Intronic
985953063 5:3237903-3237925 CAATTTCGAGAAAAAAAACCTGG - Intergenic
986133216 5:4949719-4949741 AAAATACAAAAAAATTAACCGGG - Intergenic
986187549 5:5459031-5459053 AAAATGCAAAAAAATTAGCCAGG - Intronic
986324120 5:6658954-6658976 AAATTGAAAGAAAATTAGCCAGG + Intronic
986459547 5:7956470-7956492 AAAATACAAAAAAATTAACCAGG - Intergenic
986965441 5:13264848-13264870 AAATTAAAAAAAAATTAACCAGG + Intergenic
987139132 5:14927864-14927886 AAAATACAAGAAAATTAGCCAGG - Intergenic
987140062 5:14936631-14936653 ACCTTGCAATAAAATTAACCAGG - Intergenic
987170496 5:15252331-15252353 CAATTGCAAAAATATGGACCCGG + Intergenic
987341425 5:16942846-16942868 CAACAGCAACAAAATTAGCCAGG + Intergenic
987349658 5:17010599-17010621 AAAATACAAAAAAATTAACCGGG - Intergenic
987479582 5:18436532-18436554 AAAATACAAGAAAATTAGCCAGG + Intergenic
987691267 5:21269896-21269918 AAAATACAAGAAAATTAGCCAGG - Intergenic
987849107 5:23325857-23325879 AAAATACAAGAAAATTAGCCTGG + Intergenic
987980088 5:25073076-25073098 AAAATGCAAAAAAATTAGCCGGG + Intergenic
988340668 5:29966748-29966770 CTATTTCAAAAAAATTAAGCAGG + Intergenic
988532246 5:32038000-32038022 AAAATGCAAAAAAATTAGCCAGG - Intronic
989023346 5:37037225-37037247 AAAATACAAAAAAATTAACCAGG + Intronic
989182864 5:38595892-38595914 AAAATGCAAAAAAATTAGCCGGG - Intronic
989578753 5:43012556-43012578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
989605361 5:43239396-43239418 AAAATACAAAAAAATTAACCCGG - Intronic
989640118 5:43576159-43576181 CAAAAGCAACAAAATTAGCCAGG + Intergenic
989644890 5:43620378-43620400 AAAATACAAAAAAATTAACCGGG - Intronic
989806338 5:45611815-45611837 CAATTTTAAGAAAATTATCATGG + Intronic
990372995 5:55139864-55139886 AAAATACAAAAAAATTAACCAGG + Intronic
990913091 5:60873514-60873536 AAAATACAAAAAAATTAACCGGG + Intergenic
990985713 5:61639165-61639187 CAAATACAAAAAAATTAGCCGGG - Intronic
991004768 5:61816964-61816986 CTAGTGCATGAAAATTCACCTGG - Intergenic
991172247 5:63641973-63641995 CAAAATCAAGAAAATTAGCCAGG + Intergenic
991309487 5:65220584-65220606 AAATTACAAAAAAATTAGCCGGG + Intronic
991319303 5:65351611-65351633 AAATACCAAGAAAATTAGCCAGG + Intronic
991440302 5:66640466-66640488 AAATTACAAAAAAATTAGCCAGG - Intronic
991924529 5:71691777-71691799 AAAATACAAAAAAATTAACCAGG - Intergenic
992661710 5:78968507-78968529 AAAATACAAAAAAATTAACCGGG - Intronic
993022905 5:82613168-82613190 CAAATACAAAAAAATTAGCCAGG + Intergenic
993184084 5:84593564-84593586 AAAATGCAAAAAAATTAGCCGGG + Intergenic
993456794 5:88136795-88136817 AAAATACAAAAAAATTAACCAGG - Intergenic
993534309 5:89062594-89062616 AAAATGCAAAAAAATTAGCCAGG - Intergenic
993977948 5:94505198-94505220 CAAATACAATAAAATTAGCCAGG + Intronic
994169310 5:96641376-96641398 AAACTTCAAGAAAATTAACAAGG - Intronic
994478296 5:100299048-100299070 CAATTGCAAGAGAATGAGCTTGG + Intergenic
994736144 5:103558878-103558900 CAATTGAAAGAAAAAGAAGCTGG - Exonic
995727141 5:115193062-115193084 AAAATACAAAAAAATTAACCAGG - Intergenic
995860253 5:116633633-116633655 CAAATACAAAAAAATTAGCCAGG - Intergenic
996104122 5:119478918-119478940 CAATTGCAAGAGAATTTGCAAGG - Exonic
996269143 5:121580954-121580976 CATTTTCTAGAAAAATAACCAGG + Intergenic
996687679 5:126301854-126301876 AAAATACAAGAAAATTAGCCAGG - Intergenic
996740652 5:126795783-126795805 CAAATACAAAAAAATTAGCCAGG - Intronic
997180212 5:131820230-131820252 AAAATACAAAAAAATTAACCAGG - Intronic
997278450 5:132620063-132620085 AAAATGCAATAAAATTAGCCGGG - Intronic
997533318 5:134596280-134596302 AAAATACAAAAAAATTAACCGGG - Intergenic
997935251 5:138105003-138105025 AAAATACAAAAAAATTAACCAGG + Intergenic
997935299 5:138105307-138105329 AAAATACAAAAAAATTAACCAGG + Intergenic
997935631 5:138108365-138108387 AAAATGCAAAAAAATTAGCCGGG - Intergenic
997957307 5:138289123-138289145 AAAATACAAAAAAATTAACCAGG - Intronic
997989452 5:138531884-138531906 AAAATGCAAAAAAATTAGCCGGG + Intronic
998022454 5:138781393-138781415 AAAATGCAAAAAAATTAGCCGGG + Intronic
998272903 5:140723624-140723646 AAAATACAAAAAAATTAACCAGG - Intergenic
998383121 5:141740064-141740086 AAAATGCAAAAAAATTAGCCGGG + Intergenic
998459727 5:142300974-142300996 AAATGCCAAAAAAATTAACCAGG - Intergenic
998478749 5:142443712-142443734 AAAATACAAAAAAATTAACCGGG + Intergenic
998502545 5:142646067-142646089 CAAATACAAAAAAATTAGCCGGG - Intronic
998736271 5:145144779-145144801 AAAATACAAAAAAATTAACCGGG + Intergenic
998988866 5:147792772-147792794 AAATACCAAGAAAATTAGCCGGG - Intergenic
999798576 5:155011134-155011156 CAATTGAACAAAAATTAGCCAGG + Intergenic
1000049726 5:157551988-157552010 AAAATGCAAAAAAATTAACCAGG + Intronic
1000783272 5:165511340-165511362 AAAATACAAAAAAATTAACCAGG - Intergenic
1000805349 5:165783860-165783882 AAAGTACAAAAAAATTAACCGGG + Intergenic
1000845512 5:166274992-166275014 CAAGTACAAAAAAATTAGCCGGG - Intergenic
1001154060 5:169257711-169257733 AAAATGCAAAAAAATTAGCCAGG - Intronic
1001567613 5:172710179-172710201 AAAATACAAAAAAATTAACCGGG + Intergenic
1001715197 5:173809890-173809912 AAAATACAAAAAAATTAACCGGG - Intergenic
1001782537 5:174382556-174382578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1001809491 5:174617117-174617139 AAAATACAAAAAAATTAACCAGG - Intergenic
1001909958 5:175507810-175507832 AAAATGCAAAAAAATTAACCAGG + Intronic
1001979353 5:176028307-176028329 CCATTGCAAAAAAATTCACTGGG + Intronic
1002120181 5:176997522-176997544 AAATTACAAAAAAATTAGCCGGG + Intronic
1002201879 5:177533463-177533485 AAAATACAAGAAAATTAGCCGGG - Intronic
1002238063 5:177815454-177815476 CCATTGCAAAAAAATTCACTGGG - Intergenic
1002507125 5:179687261-179687283 CAAATACAAAAAAATTAGCCGGG - Intronic
1002935435 6:1667883-1667905 CATTAGAAAGAAACTTAACCAGG - Intronic
1003354610 6:5355515-5355537 AAATTACAAAAAAATTAGCCGGG - Intronic
1003609562 6:7598023-7598045 AAAATACAAGAAAATTAGCCAGG - Intronic
1003688279 6:8326497-8326519 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1003718361 6:8672745-8672767 AAAATACAAGAAAATTAGCCGGG + Intergenic
1003890550 6:10560247-10560269 AAAATACAAAAAAATTAACCGGG - Intronic
1004085832 6:12448230-12448252 CAAGTACAAAAAAATTAGCCTGG - Intergenic
1004232341 6:13844881-13844903 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1004377066 6:15099632-15099654 AAAATACAAGAAAATTAGCCAGG - Intergenic
1004386000 6:15173235-15173257 AAAATACAAAAAAATTAACCAGG + Intergenic
1004388689 6:15191202-15191224 AAAATACAAGAAAATTAGCCGGG - Intergenic
1004400420 6:15283500-15283522 AAAATACAAGAAAATTAGCCGGG - Intronic
1004572978 6:16865823-16865845 AAAATACAAAAAAATTAACCAGG - Intergenic
1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG + Intronic
1004990719 6:21135260-21135282 CAATTTCAAGATAAGAAACCAGG - Intronic
1005017524 6:21388143-21388165 AAATTAAAGGAAAATTAACCAGG - Intergenic
1005026068 6:21464311-21464333 AAAATACAAAAAAATTAACCGGG - Intergenic
1005271525 6:24169755-24169777 CAAATACAAAAAAATTAGCCAGG - Intergenic
1005296632 6:24433651-24433673 AAAATACAAAAAAATTAACCGGG - Intronic
1005485469 6:26295176-26295198 AAAATGCAAGGAAATTAGCCAGG - Intergenic
1005487776 6:26317522-26317544 AAAATACAAAAAAATTAACCCGG - Intergenic
1005580399 6:27228623-27228645 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1005591624 6:27334707-27334729 AAAATACAAAAAAATTAACCAGG + Intergenic
1005609610 6:27511028-27511050 AAAATACAAAAAAATTAACCAGG + Intergenic
1005722594 6:28617439-28617461 CAAATACAAAAAAATTAGCCGGG - Intergenic
1005735392 6:28740753-28740775 AAATTACAAAAAAATTAGCCGGG + Intergenic
1005848203 6:29799305-29799327 AAATTACAAAAAAATTAGCCGGG + Intergenic
1006048861 6:31324453-31324475 AAAATACAAAAAAATTAACCGGG - Intronic
1006307221 6:33230513-33230535 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1006483767 6:34320673-34320695 AAAATACAAGAAAATTAGCCAGG + Intronic
1006530669 6:34650589-34650611 AAACTGCAAAAAAATTAGCCAGG - Intronic
1006553096 6:34841225-34841247 AAAATGCAAAAAAATCAACCAGG - Intronic
1006609332 6:35284250-35284272 AAAATACAAAAAAATTAACCAGG - Intronic
1006996495 6:38266131-38266153 CCCATGTAAGAAAATTAACCAGG - Intronic
1007018302 6:38492058-38492080 CAACTGAAAAAAGATTAACCGGG + Intronic
1007774325 6:44216489-44216511 CAAATACAAAAAAATTAGCCTGG + Intergenic
1007879979 6:45153907-45153929 AAAATGCAAAAAAATTAGCCAGG + Intronic
1007897073 6:45373709-45373731 AAATTACAAAAAAATTAGCCGGG - Intronic
1008251941 6:49251000-49251022 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1008298087 6:49802921-49802943 CTATTGCAAGACAATTATGCAGG - Intergenic
1008395591 6:51003097-51003119 AAAATGCAAGAAAAGTAACCAGG + Intergenic
1009024448 6:57981964-57981986 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1009189221 6:60609489-60609511 AAAATACAAAAAAATTAACCAGG - Intergenic
1009332523 6:62441410-62441432 CAGCTGCAAGAAAATTAACTTGG - Intergenic
1009609173 6:65916787-65916809 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1009771693 6:68152231-68152253 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1009861127 6:69333767-69333789 AAAATGCAAAAAAATTAGCCGGG + Intronic
1009907592 6:69888630-69888652 AAATTACAAAAAAATTAGCCGGG + Intronic
1010132693 6:72513206-72513228 AAAATACAAGAAAATTAGCCGGG - Intergenic
1010256266 6:73761679-73761701 AAAATGCAAAAAAATTAGCCAGG - Intronic
1010587847 6:77676364-77676386 CAAATAAAAAAAAATTAACCAGG + Intergenic
1010627964 6:78161753-78161775 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1011117673 6:83911894-83911916 AAATTACAAAAATATTAACCAGG + Intronic
1011391392 6:86857785-86857807 CATTTGCAACAACATGAACCTGG - Intergenic
1011467857 6:87676914-87676936 AAAATACAAGAAAATTAGCCGGG + Intronic
1011813922 6:91166190-91166212 TAATTTCGAGAGAATTAACCCGG - Intergenic
1012069133 6:94589808-94589830 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1012072147 6:94636383-94636405 CTATTACTAGAAAATTAACAAGG - Intergenic
1012186410 6:96222769-96222791 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1012518465 6:100091899-100091921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1012809126 6:103935797-103935819 CAAATACAAAAAAATTAGCCGGG - Intergenic
1013090601 6:106897056-106897078 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1013133999 6:107262067-107262089 AAAATGCAAAAAAATTAGCCGGG - Intronic
1013238754 6:108223656-108223678 AAAATACAAGAAAATTAGCCAGG - Intronic
1013241931 6:108254301-108254323 CAAATACAAAAAAATTAGCCAGG + Intronic
1013448511 6:110255678-110255700 CACTTGCAAATAAATTAACCAGG - Intronic
1013553733 6:111235653-111235675 AAATTACAAAAAAATTAGCCGGG + Intergenic
1013795673 6:113885907-113885929 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1014950170 6:127545144-127545166 AAAATACAAGAAAATTAGCCGGG - Intronic
1015381916 6:132579474-132579496 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1015408497 6:132864658-132864680 AAAATACAAAAAAATTAACCAGG + Intergenic
1015532743 6:134237213-134237235 AAAATGCAAAAAAATTAGCCGGG - Intronic
1016287875 6:142493461-142493483 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1016319546 6:142827744-142827766 TAATTGCAAGAAAATAATCTGGG + Intronic
1016922557 6:149310173-149310195 CAAATACAAAAAAATTAGCCAGG + Intronic
1017170899 6:151453131-151453153 CACTTTGAAGAAAATAAACCTGG + Intronic
1017192904 6:151672317-151672339 CAAATACAAAAAAATTAGCCTGG - Intronic
1017216865 6:151918296-151918318 CACTTGCATGAGATTTAACCAGG - Intronic
1017244225 6:152204964-152204986 CAAAAGGAAGAAAATGAACCTGG + Intronic
1017301871 6:152869894-152869916 CATTTGAAAAAAAATTAGCCAGG - Intergenic
1017869345 6:158473677-158473699 AAAATACAAGAAAATTAGCCGGG - Intronic
1018535847 6:164818332-164818354 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1018763427 6:166910129-166910151 AAAATACAAGAAAATTAGCCGGG - Intronic
1019182989 6:170203717-170203739 AAAATGAAAGAAAGTTAACCTGG + Intergenic
1019783873 7:2961010-2961032 AAAGTGCAAAAAAATTAGCCGGG + Intronic
1019809685 7:3156151-3156173 TAATTTAAAAAAAATTAACCAGG + Intronic
1019869367 7:3744649-3744671 CAAATACAAAAAAATTAGCCAGG + Intronic
1020102277 7:5400880-5400902 AAAATACAAAAAAATTAACCGGG + Intronic
1020175795 7:5881156-5881178 AAAATACAAAAAAATTAACCGGG + Intronic
1020606454 7:10343983-10344005 TAATTGTAAAAATATTAACCTGG - Intergenic
1020839906 7:13203333-13203355 CAAATACAAAAAAATTAGCCGGG - Intergenic
1020847194 7:13301147-13301169 AAAATGCAAGAAAATTATCTTGG + Intergenic
1020906667 7:14071895-14071917 AAATTACAAAAAAATTAGCCGGG - Intergenic
1021090661 7:16478892-16478914 AAAATGCAAAAAAATTAGCCAGG - Intronic
1021557489 7:21935846-21935868 AAAATGCAAAAAAATTAGCCAGG + Intronic
1021570310 7:22058285-22058307 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1021610283 7:22451034-22451056 CAAATGCAAAAAAATTAGCCAGG + Intronic
1021715962 7:23462520-23462542 AAAATACAAAAAAATTAACCGGG - Intronic
1022074572 7:26954637-26954659 CAAATACAAAAAAATTAGCCGGG - Intronic
1022148378 7:27571381-27571403 AAAATACAAGAAAATTAGCCGGG - Intronic
1022556668 7:31305186-31305208 AAATTCCAAAAAAATTAGCCAGG + Intergenic
1023426962 7:40047291-40047313 CAATTACAAGAGAATTATCAGGG - Intronic
1023506248 7:40902417-40902439 AAAATACAAAAAAATTAACCGGG + Intergenic
1023698145 7:42868267-42868289 CAAATACAAAAAAATTAGCCAGG + Intergenic
1023756447 7:43422521-43422543 AAAATACAAAAAAATTAACCAGG - Intronic
1023775179 7:43598921-43598943 AAATTACAAAAAAATTAGCCAGG - Intronic
1024193168 7:47033291-47033313 AAAATACAAAAAAATTAACCGGG - Intergenic
1024355195 7:48407313-48407335 AAAATACAAAAAAATTAACCAGG + Intronic
1024858476 7:53810358-53810380 AAAATGCAAAAAAATTAGCCTGG - Intergenic
1024960878 7:54974347-54974369 AAAATACAAAAAAATTAACCAGG + Intergenic
1025152173 7:56566592-56566614 CAAATACAAAAAAATTAGCCAGG + Intergenic
1025993401 7:66512825-66512847 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1026039552 7:66856262-66856284 AAAATACAAAAAAATTAACCAGG - Intergenic
1026050987 7:66946417-66946439 AAAATGCAAAAAAATTAGCCAGG + Intronic
1026059696 7:67015160-67015182 AAAATGCAAAAAAATTAGCCAGG - Intronic
1026202049 7:68222792-68222814 CAATTGCATGAAAATCAAACAGG + Intergenic
1026334308 7:69380673-69380695 AAATTAAAAAAAAATTAACCAGG - Intergenic
1026352356 7:69528564-69528586 AAAATGCAAAAAAATTACCCGGG - Intergenic
1026476302 7:70738832-70738854 CAAATACAAGGAAATTAACCTGG + Intronic
1026545941 7:71322110-71322132 AAAATGAAAGAAAATTAGCCAGG - Intronic
1026601014 7:71777187-71777209 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1026677443 7:72439735-72439757 CAAATACAAAAAAATTAACCAGG - Intronic
1026886074 7:73946982-73947004 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1026886435 7:73950770-73950792 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1026919041 7:74141544-74141566 AAAATACAAGAAAATTAGCCGGG + Intergenic
1026983646 7:74540920-74540942 AAAATACAAAAAAATTAACCAGG - Intronic
1027026421 7:74855258-74855280 AAAATACAAAAAAATTAACCGGG - Intergenic
1027061334 7:75088856-75088878 AAAATACAAAAAAATTAACCGGG + Intergenic
1027112030 7:75447861-75447883 AAAATACAAAAAAATTAACCAGG + Intronic
1027121590 7:75526214-75526236 AAATAGCAAAAAAATTAGCCAGG + Intergenic
1027593206 7:80140142-80140164 CAAATACAAAAAAATTAGCCGGG - Intronic
1027660122 7:80978857-80978879 CAAGTACAAAAAAATTAGCCGGG - Intergenic
1027910047 7:84238873-84238895 AAACTGCAAAAAAATTAGCCAGG - Intronic
1027914625 7:84299869-84299891 AAAATACAAAAAAATTAACCAGG + Intronic
1028149056 7:87351146-87351168 AAAATGCAAAAAAATTAGCCAGG + Intronic
1028435586 7:90799527-90799549 AAAATACAAAAAAATTAACCAGG + Intronic
1028996283 7:97104047-97104069 CAAATGCAAAAAAATTGACAAGG - Intergenic
1029016462 7:97320000-97320022 AAAATACAAAAAAATTAACCAGG - Intergenic
1029106753 7:98183546-98183568 AAAATACAAAAAAATTAACCAGG - Intronic
1029182071 7:98710005-98710027 AAAATACAAAAAAATTAACCGGG - Intergenic
1029201824 7:98844323-98844345 AAATTACAAAAAAATTAGCCAGG + Intergenic
1029266848 7:99349209-99349231 CAATTTTAAAAAAATTAGCCAGG - Intronic
1029415289 7:100439034-100439056 CAAATACAAAAAAATTAGCCGGG + Intergenic
1029623436 7:101704455-101704477 AAATTACAAAAAAATTAGCCAGG + Intergenic
1029992542 7:104975239-104975261 CAAATACAAAAAAATTAGCCAGG + Intergenic
1030027069 7:105334677-105334699 AAAATGCAAAAAAATTAGCCAGG + Intronic
1030027115 7:105335008-105335030 CAAATACAAAAAAATTAGCCAGG + Intronic
1030212294 7:107008435-107008457 AAAATACAAAAAAATTAACCGGG - Intergenic
1030261991 7:107575644-107575666 CAATGAAAAGAAAATAAACCAGG + Intronic
1030293261 7:107892704-107892726 AAAATACAAGAAAATTAGCCGGG - Intronic
1030406310 7:109118673-109118695 AAACTACAAAAAAATTAACCAGG + Intergenic
1031041645 7:116844431-116844453 AAATTACAAAAAAATTAACCGGG + Intronic
1031377636 7:121047863-121047885 AAAATGCAAAAAAATTAGCCGGG - Intronic
1031651129 7:124291118-124291140 AAATTACAAAAAAATTAGCCAGG - Intergenic
1031713739 7:125081160-125081182 CAAATACAACAAAATTAGCCAGG - Intergenic
1031768544 7:125812035-125812057 AAAATACAAGAAAATTAGCCAGG - Intergenic
1031933996 7:127717021-127717043 AGATTGAAAGAATATTAACCTGG + Intronic
1032210276 7:129907645-129907667 CAATTTTAGGAAAATTAATCTGG + Intronic
1033180036 7:139167778-139167800 CAAATACAAAAAAATTAGCCGGG + Intronic
1033251593 7:139765155-139765177 CTTTGGCAAGGAAATTAACCTGG + Intronic
1033329957 7:140409534-140409556 AAAATACAAAAAAATTAACCGGG + Intronic
1033339947 7:140484278-140484300 CAATAGCAACAAAAATCACCTGG - Intergenic
1034170143 7:149056547-149056569 AAAATACAAGAAAATTAGCCAGG - Intergenic
1034173578 7:149082739-149082761 AAAATGCAAAAAAATTAGCCAGG - Intronic
1034187656 7:149191453-149191475 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1034326562 7:150239910-150239932 AAATTCAAAAAAAATTAACCAGG - Intergenic
1034394962 7:150815370-150815392 AAATTACAAAAAAATTATCCGGG + Intergenic
1034556482 7:151853597-151853619 AAAATACAAGAAAATTAGCCAGG + Intronic
1034600963 7:152255325-152255347 CAAATACAAAAAAATTAGCCAGG - Intronic
1034838820 7:154376642-154376664 CCATTGCAAGTCAATTAACCAGG - Intronic
1035080949 7:156215500-156215522 CAATTCCAAGAAAAGGAACTGGG - Intergenic
1035110820 7:156480194-156480216 CACTTGCCAGAAAGTGAACCGGG - Intergenic
1035166722 7:156994833-156994855 AAAATGCAAAAAAATTAGCCGGG + Intronic
1035384481 7:158461333-158461355 AAAATACAAAAAAATTAACCGGG + Intronic
1035710994 8:1714057-1714079 AAAATACAAAAAAATTAACCGGG + Intergenic
1035877691 8:3209475-3209497 AAATTACAAAAAAATTAGCCGGG - Intronic
1035914939 8:3608601-3608623 AAAATGCAAAAAAATTAGCCGGG + Intronic
1036006362 8:4668608-4668630 AAAATGCAAAAAAATTAGCCAGG - Intronic
1036026456 8:4914415-4914437 AAAATACAAAAAAATTAACCGGG + Intronic
1036066573 8:5387398-5387420 CCCTTGCAAAAAAATTAACAAGG + Intergenic
1036280782 8:7399269-7399291 CAAATACAAAAAAATTAACCGGG + Intergenic
1036340683 8:7912303-7912325 CAAATACAAAAAAATTAACCGGG - Intergenic
1036480046 8:9131534-9131556 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1036929798 8:12944521-12944543 AAAATACAAAAAAATTAACCAGG + Intergenic
1037129112 8:15386058-15386080 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1037202462 8:16274419-16274441 CAACAGAAAGAAAATTAACCTGG + Intronic
1037335093 8:17784273-17784295 CAGTTGTAAGAAAATTAGCAGGG - Intronic
1037850137 8:22320749-22320771 AAAATGCAAAAAAATTAGCCAGG - Intronic
1037939422 8:22940647-22940669 AAAATACAAAAAAATTAACCAGG - Intronic
1038501936 8:28052228-28052250 CAATTTCAAAAATATTAAACGGG - Intronic
1038625349 8:29187368-29187390 AAATACCAAAAAAATTAACCAGG + Intronic
1038647069 8:29370843-29370865 AAAATACAAAAAAATTAACCAGG + Intergenic
1038853396 8:31303202-31303224 CAGATGAAAGAAAATTATCCTGG - Intergenic
1039291147 8:36095548-36095570 AAAATACAAAAAAATTAACCGGG + Intergenic
1039458497 8:37724400-37724422 AAAATACAAAAAAATTAACCAGG + Intergenic
1039491983 8:37954633-37954655 AAATTACAAAAAAATTAGCCAGG + Intergenic
1040074668 8:43217320-43217342 AAAATACAAAAAAATTAACCAGG + Intergenic
1040478548 8:47802811-47802833 AAAATACAAAAAAATTAACCAGG - Intronic
1040776437 8:51049081-51049103 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1040843847 8:51814587-51814609 CAAATACAAAAAAATTAGCCAGG + Intergenic
1040886216 8:52266700-52266722 AAAATCCAAAAAAATTAACCAGG - Intronic
1040973505 8:53163884-53163906 AAAATACAAAAAAATTAACCGGG - Intergenic
1041046457 8:53891458-53891480 AAAATGCAAAAAAATTAGCCAGG + Intronic
1041054840 8:53974014-53974036 AAAATACAAGAAAATTAGCCAGG + Intronic
1041192190 8:55365544-55365566 AAATTACAAAAAAATTAGCCGGG + Intronic
1041250849 8:55933781-55933803 GAATTGCAAGACAATTAAAGAGG - Intronic
1041273163 8:56129459-56129481 AAATTACAAAAAAATTAGCCGGG + Intergenic
1041856933 8:62467928-62467950 AAAATGCAAAAAAATTAGCCAGG - Intronic
1042529104 8:69796453-69796475 AAAATACAAGAAAATTAGCCAGG + Intronic
1042837150 8:73089393-73089415 AAATTACAAAAAAATTAGCCGGG + Intronic
1043628573 8:82296506-82296528 TACATGCAAGAAAATTAAACTGG + Intergenic
1044829677 8:96235097-96235119 CAATGGCAAGAAAATTTATAGGG + Intronic
1044986130 8:97757878-97757900 CAAATACCAAAAAATTAACCAGG + Intergenic
1045143733 8:99315795-99315817 CCAATACAAAAAAATTAACCGGG - Intronic
1045216800 8:100157382-100157404 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1045682762 8:104680125-104680147 GAAATACAAGAAAATTAGCCAGG - Intronic
1045963843 8:108000839-108000861 AAAATACAAAAAAATTAACCAGG + Intronic
1046005506 8:108477666-108477688 GAATTTCAAGAAAATTTTCCTGG + Intronic
1046054047 8:109058353-109058375 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1046157270 8:110308869-110308891 AAAATACAAAAAAATTAACCGGG + Intergenic
1046548647 8:115683898-115683920 CAAATACAAAAAAATTAGCCAGG + Intronic
1046694829 8:117328461-117328483 TCATTTCTAGAAAATTAACCAGG + Intergenic
1046965284 8:120157823-120157845 AAAATTCAAGAAAATTAGCCGGG + Intronic
1047191495 8:122682868-122682890 AAATTACAAAAAAATTAGCCGGG + Intergenic
1047242447 8:123103981-123104003 CAATGACAAGAAAATAAAACTGG - Intronic
1047272292 8:123373626-123373648 CAAATACAAAAAAATTAGCCAGG + Intronic
1047273084 8:123381338-123381360 AAATTGCAAAAAAATTAGCCAGG + Intronic
1047291076 8:123531138-123531160 AAAATACAAGAAAATTAGCCAGG - Intronic
1047456138 8:125013826-125013848 CAAGGGCAAGAAAATTCACTGGG - Intronic
1047674782 8:127188804-127188826 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1047708920 8:127530583-127530605 AAATTACAAAAAAATTAGCCAGG + Intergenic
1047835132 8:128681229-128681251 AAAATACAAAAAAATTAACCGGG - Intergenic
1048211329 8:132456770-132456792 AAAATACAAGAAAATTAGCCGGG - Intronic
1049194980 8:141310248-141310270 CCATTGAAAGAAAAATCACCAGG - Intergenic
1049628620 8:143638575-143638597 AAAATGCAAAAAAATTAGCCGGG + Intronic
1049830326 8:144697164-144697186 AAAATACAAGAAAATTAGCCAGG + Intergenic
1050076238 9:1868217-1868239 CAATAGCAAGAAAAATAATCTGG + Intergenic
1050355055 9:4774770-4774792 CAAATACAAAAAAATTAGCCAGG + Intergenic
1050474471 9:6025743-6025765 AAAATACAAAAAAATTAACCAGG + Intergenic
1050544209 9:6695946-6695968 CTCTTACAAGAAAAGTAACCTGG - Intergenic
1051065962 9:13103350-13103372 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1051273691 9:15379262-15379284 AAAATACAAAAAAATTAACCGGG - Intergenic
1051294788 9:15584025-15584047 AAAATACAAGAAAATTAGCCGGG - Intronic
1051409800 9:16777538-16777560 AAAATACAAAAAAATTAACCAGG + Intronic
1051444585 9:17126888-17126910 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1051609774 9:18949802-18949824 CAATAGGAAGAAAAGTCACCAGG + Intronic
1051639666 9:19212916-19212938 AAAATACAAAAAAATTAACCAGG - Intergenic
1052354799 9:27493478-27493500 AAAATACAAGAAAATTAGCCAGG + Intronic
1052421039 9:28243297-28243319 AAAATACAAAAAAATTAACCGGG + Intronic
1052601658 9:30639976-30639998 AAATTACAAAAAAATTATCCGGG + Intergenic
1053170643 9:35878580-35878602 CAATTGCATTAAAAATGACCAGG + Intergenic
1053408797 9:37901462-37901484 GAATTACAAGAAAATAAGCCAGG - Intronic
1053426446 9:38013441-38013463 AAACTACAAGAAAATTAGCCTGG + Intronic
1053593742 9:39538530-39538552 AAATTGCAAGCAAATTAATCTGG - Intergenic
1053658481 9:40245609-40245631 CAAAAGCAGAAAAATTAACCAGG + Intronic
1053851529 9:42293581-42293603 AAATTGCAAGCAAATTAATCTGG - Intergenic
1053864469 9:42422694-42422716 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1054370601 9:64391883-64391905 CAAAAGCAGAAAAATTAACCAGG + Intronic
1054526117 9:66130613-66130635 CAAAAGCAGAAAAATTAACCAGG - Intronic
1054572508 9:66826423-66826445 AAATTGCAAGCAAATTAATCTGG + Intergenic
1054593453 9:67037627-67037649 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1054678231 9:67881632-67881654 CAAAAGCAGAAAAATTAACCAGG + Intronic
1055405632 9:75970780-75970802 AAAATACAAAAAAATTAACCAGG - Intronic
1055919339 9:81441784-81441806 AAAATACAAGAAAATTACCCAGG - Intergenic
1055944301 9:81678985-81679007 TAATTTAAAAAAAATTAACCAGG + Intronic
1056218512 9:84428472-84428494 TAATTTTAAGAAAATTAACTGGG - Intergenic
1056339459 9:85611283-85611305 CAATTGTAAGAATTTTAAACAGG + Intronic
1056375992 9:86011517-86011539 AAAATACAAAAAAATTAACCAGG - Intronic
1056377817 9:86031620-86031642 TAAATACAAGAAAATTAGCCAGG - Intronic
1056517214 9:87365438-87365460 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1056583449 9:87912619-87912641 AAAATACAAAAAAATTAACCGGG + Intergenic
1056613481 9:88140956-88140978 AAAATACAAAAAAATTAACCGGG + Intergenic
1056977838 9:91276268-91276290 AAATTGCAAAAACATTAGCCGGG + Intronic
1057069055 9:92080281-92080303 CAAATGCAGAAAAGTTAACCAGG - Intronic
1057137513 9:92703642-92703664 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1057158538 9:92867319-92867341 AAATTTAAAGAAAATTAGCCAGG + Intronic
1057846900 9:98532865-98532887 CAAATTCAGGAAAATTAACTTGG + Intronic
1057882428 9:98802648-98802670 CAATACCAAAAAAATTAGCCAGG + Intergenic
1057924636 9:99133841-99133863 AAAATGCAAAAAAATTAGCCGGG + Intronic
1057940770 9:99281690-99281712 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1058369214 9:104245787-104245809 CATTTGCTACAAAATTAGCCAGG + Intergenic
1058395205 9:104544582-104544604 AAAATACAAAAAAATTAACCAGG + Intergenic
1058663581 9:107288604-107288626 AAAATACAAAAAAATTAACCAGG - Intronic
1058939465 9:109799652-109799674 AAAATACAAAAAAATTAACCAGG - Intronic
1059266479 9:113036798-113036820 AAAATACAAAAAAATTAACCAGG - Intergenic
1059697547 9:116743388-116743410 AAAATGCAAAAAAATTAGCCAGG + Intronic
1059889718 9:118787738-118787760 CACTTTCAACAAAATTAAGCAGG - Intergenic
1060382130 9:123185869-123185891 AAAATGCAAAAAAATTAGCCGGG + Intronic
1060527948 9:124331103-124331125 AAATAGCAAAAAAATTAGCCAGG + Intronic
1061103075 9:128507421-128507443 AAAATACAAAAAAATTAACCAGG + Intronic
1061136810 9:128739340-128739362 AAAATACAAAAAAATTAACCGGG + Intronic
1061345575 9:130022363-130022385 AAAATACAAAAAAATTAACCGGG - Intronic
1061984523 9:134122288-134122310 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1062102379 9:134735050-134735072 AAACTACAAAAAAATTAACCAGG + Intronic
1062336224 9:136070345-136070367 AAAATGCAAAAAAATTAGCCGGG + Intronic
1062659674 9:137623050-137623072 AAAATACAAGAAAATTAGCCGGG + Intronic
1202786974 9_KI270719v1_random:34431-34453 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1202787511 9_KI270719v1_random:42524-42546 CAATTGAAAAAAAAATAGCCAGG - Intergenic
1203363986 Un_KI270442v1:242033-242055 AAAATACAAAAAAATTAACCAGG - Intergenic
1185508939 X:648383-648405 AAAATGCAAAAAAATTACCCAGG - Intronic
1185528949 X:801902-801924 CTAATGCTAGAAAATTAGCCAGG + Intergenic
1185624158 X:1470995-1471017 AAATTACAAAAAAATTAGCCAGG - Intronic
1185790792 X:2927418-2927440 AAATTACAAAAAAATTAGCCGGG - Intronic
1186239284 X:7548913-7548935 CAATTGCAAGAAAAAAAAGGGGG - Intergenic
1186545778 X:10447914-10447936 CAATTGCTAAAATATTTACCTGG - Exonic
1186908521 X:14136875-14136897 CAAGTGTAAGCAAATTATCCTGG - Intergenic
1186978404 X:14933129-14933151 CAAATACAAAAAAATTAACCAGG + Intergenic
1186985405 X:15008525-15008547 CAAATACAAAAAAATTAGCCGGG - Intergenic
1187342161 X:18431020-18431042 AAAATGCAAAAAAATTAGCCAGG - Intronic
1187455984 X:19441613-19441635 AAAATACAAAAAAATTAACCAGG - Intronic
1187476092 X:19612422-19612444 AAAATACAAAAAAATTAACCAGG - Intronic
1187898323 X:24003390-24003412 AAAATGCAAAAAAATTAGCCGGG + Intronic
1187914909 X:24144357-24144379 CAAGTACAAAAAAATTAGCCAGG - Intergenic
1187935075 X:24328122-24328144 AAAATACAAAAAAATTAACCAGG + Intergenic
1188118783 X:26279082-26279104 AAAATACAAGAAAATTAGCCGGG + Intergenic
1188479818 X:30625765-30625787 AAAATACAAAAAAATTAACCAGG + Intergenic
1189150183 X:38698781-38698803 AAAATTCAAGAAAATTAGCCGGG - Intergenic
1189444940 X:41072153-41072175 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1190221452 X:48514908-48514930 CAATTGTAAAAAAATTAGCCAGG + Intronic
1190239414 X:48645793-48645815 AAATTGTAAGAAAATTAGGCAGG - Intergenic
1190497646 X:51041906-51041928 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1190799359 X:53773080-53773102 TAAATGCAAAAAAATTAGCCAGG - Intergenic
1191238542 X:58158514-58158536 CAAATACAAAAAAATTAGCCAGG - Intergenic
1191596698 X:62952101-62952123 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1191827142 X:65377936-65377958 AAAATTCAAAAAAATTAACCGGG + Intronic
1192110524 X:68359434-68359456 CAATTGAAAGGAAATTTCCCTGG + Intronic
1192150560 X:68709656-68709678 AAATAAAAAGAAAATTAACCAGG + Intronic
1192374251 X:70543019-70543041 AAAATGCAAAAAAATTAGCCGGG + Intronic
1192791525 X:74386812-74386834 AAATTACAAAAAAATTAGCCAGG + Intergenic
1193101661 X:77621468-77621490 AAAATGCAAAAAAATTAGCCAGG - Intronic
1193283805 X:79687726-79687748 CCATGGGAAAAAAATTAACCTGG + Intergenic
1193368581 X:80664824-80664846 GAATAGGAAGAAAATTAACAAGG - Intergenic
1193383423 X:80843470-80843492 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1193454239 X:81710080-81710102 CAAAAGAAAGAAAATTAAGCAGG + Intergenic
1193515883 X:82462842-82462864 CAGTTGCAGGAAAATGAATCTGG + Intergenic
1193602562 X:83525994-83526016 AAAGTACAAAAAAATTAACCAGG + Intergenic
1194267872 X:91778134-91778156 CAGACGCCAGAAAATTAACCAGG - Intergenic
1194553282 X:95327524-95327546 AAAATGCAAAAAAATTAACTGGG + Intergenic
1194644140 X:96437782-96437804 CAATAGCAAGAACCTTAACAAGG + Intergenic
1194807659 X:98349206-98349228 CCCTTACAAGAAAAGTAACCTGG - Intergenic
1195044014 X:101039737-101039759 CAAATACAAAAAAATTAGCCAGG + Intronic
1195154435 X:102109264-102109286 AAAATACAAAAAAATTAACCAGG + Intergenic
1195271953 X:103240942-103240964 AAAATACAAAAAAATTAACCAGG - Intergenic
1195478002 X:105309193-105309215 GAAATACAAAAAAATTAACCAGG - Intronic
1195516006 X:105776795-105776817 CTAATGCAAAAAAATTAGCCTGG - Intergenic
1196111311 X:111950162-111950184 CAAATACAAAAAAATTAGCCAGG + Intronic
1196436745 X:115681527-115681549 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1196608030 X:117677744-117677766 CAATTACATAAAAATTAAACTGG + Intergenic
1196727425 X:118908878-118908900 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1196782446 X:119395660-119395682 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1196835934 X:119813720-119813742 AAAATACAAAAAAATTAACCGGG - Intergenic
1196839925 X:119850136-119850158 AAATTTAAAGAAAATTAGCCAGG + Intronic
1196888361 X:120268635-120268657 TAAATGCAAAGAAATTAACCTGG + Intronic
1196898985 X:120364875-120364897 AAATTAAAAAAAAATTAACCAGG - Intronic
1196900400 X:120377092-120377114 CATTTGCAAGACAACTATCCAGG - Intronic
1197613047 X:128660175-128660197 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1197663915 X:129202683-129202705 AAAGTGCAAAAAAATTAGCCAGG - Intergenic
1197875510 X:131100488-131100510 CAGTTGCAAGGAAATTAATTAGG - Intergenic
1198083768 X:133264196-133264218 CAAATACAAAAAAATTAGCCAGG - Intergenic
1198414164 X:136402971-136402993 CAAGTGCCAGAAAATCAACTTGG - Intronic
1198505056 X:137293247-137293269 AAATTAAAAGAAAATTAGCCAGG - Intergenic
1198538409 X:137610075-137610097 CAATAAAAAGAAAATTAGCCAGG - Intergenic
1198746518 X:139896765-139896787 AAATTACAAAAAAATTAGCCGGG - Intronic
1198767773 X:140095854-140095876 AAATTACAAAAAAATTAGCCAGG - Intergenic
1199146528 X:144375670-144375692 AAATTGCAGCAAAATTAGCCAGG + Intergenic
1199722443 X:150551582-150551604 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1200156462 X:153978945-153978967 AAAATACAAAAAAATTAACCAGG - Intronic
1200172640 X:154088986-154089008 CAAATACAAAAAAATTAGCCAGG + Intronic
1200241205 X:154495018-154495040 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1200311616 X:155084521-155084543 AAAATGCAAAAAAATTAGCCGGG - Intronic
1200413484 Y:2885025-2885047 AAATTACAAAAAAATTAGCCGGG + Intronic
1200585080 Y:4999059-4999081 CAGACGCCAGAAAATTAACCAGG - Intergenic
1200781431 Y:7219892-7219914 AAAATACAAGAAAATTAGCCAGG + Intergenic
1200839601 Y:7767577-7767599 CAATTTCAACAAAGTTTACCAGG + Intergenic
1201267287 Y:12220093-12220115 AAAATGCAAAAAAATTAACTGGG - Intergenic
1202588382 Y:26456204-26456226 AAAATGCAAAAAAATTAGCCGGG - Intergenic