ID: 922416579

View in Genome Browser
Species Human (GRCh38)
Location 1:225427911-225427933
Sequence CGCCGCGGGGAGCTGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 429}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922416572_922416579 -9 Left 922416572 1:225427897-225427919 CCCCTCGAAGAACGCGCCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 22
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416563_922416579 18 Left 922416563 1:225427870-225427892 CCGGCCTCGGGCTTCCTCCCCCA 0: 1
1: 0
2: 4
3: 35
4: 483
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416568_922416579 0 Left 922416568 1:225427888-225427910 CCCCAGCGGCCCCTCGAAGAACG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416564_922416579 14 Left 922416564 1:225427874-225427896 CCTCGGGCTTCCTCCCCCAGCGG 0: 1
1: 0
2: 4
3: 31
4: 223
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416567_922416579 1 Left 922416567 1:225427887-225427909 CCCCCAGCGGCCCCTCGAAGAAC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416560_922416579 30 Left 922416560 1:225427858-225427880 CCGGCCGCTGCGCCGGCCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 290
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416570_922416579 -2 Left 922416570 1:225427890-225427912 CCAGCGGCCCCTCGAAGAACGCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416566_922416579 4 Left 922416566 1:225427884-225427906 CCTCCCCCAGCGGCCCCTCGAAG 0: 1
1: 0
2: 1
3: 19
4: 426
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416569_922416579 -1 Left 922416569 1:225427889-225427911 CCCAGCGGCCCCTCGAAGAACGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416574_922416579 -10 Left 922416574 1:225427898-225427920 CCCTCGAAGAACGCGCCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429
922416562_922416579 26 Left 922416562 1:225427862-225427884 CCGCTGCGCCGGCCTCGGGCTTC 0: 1
1: 0
2: 0
3: 25
4: 202
Right 922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922416579 Original CRISPR CGCCGCGGGGAGCTGGGAGC AGG Intronic
900087377 1:904946-904968 CGCCGCGGGGAGGCGGGTGAGGG + Intergenic
900120058 1:1045035-1045057 CTCCTCTGGGAGCTGGGATCGGG + Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900154285 1:1197857-1197879 GGGCGCGGGGCGCTGGGCGCGGG - Exonic
900156430 1:1205112-1205134 CCCTGCGGGGAGGTGGGGGCGGG - Intronic
900191918 1:1355687-1355709 GTCCGCGGTGAGCTGGGAGGCGG - Exonic
900349407 1:2227690-2227712 CGCCGAGGGCCGCTGGGCGCGGG - Intergenic
900409983 1:2508078-2508100 GGCTGGGGGGAGCTGGCAGCAGG - Intergenic
900970791 1:5991735-5991757 CACCGCGGGGAACTGACAGCCGG + Intronic
901086033 1:6613199-6613221 CTCAGCGGGGAGCGGGGAGCGGG + Intronic
902585659 1:17437774-17437796 CGCCGCGGGGAGGGGGCGGCCGG - Intronic
902600851 1:17539583-17539605 CCTCGCGGCGCGCTGGGAGCAGG + Intergenic
903129953 1:21272643-21272665 CACAGCGGGGAGCTGTCAGCTGG - Intronic
903750317 1:25617159-25617181 GGGCGCCGGGAGCTGGGAGCCGG - Intergenic
903795095 1:25922819-25922841 GCTCGCGGGGACCTGGGAGCGGG + Intergenic
903925281 1:26827161-26827183 CGCGGCAGGGGGCTGGGAGGGGG - Intronic
904080999 1:27872559-27872581 AGCCGCGGGGACCATGGAGCCGG + Exonic
904205930 1:28855300-28855322 CGAAGTGGGGAGGTGGGAGCGGG + Intronic
904744544 1:32702831-32702853 GGCCGCGCGGACCTGGGGGCGGG + Exonic
904840737 1:33370344-33370366 AGAAGCTGGGAGCTGGGAGCTGG - Intronic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905389376 1:37626433-37626455 AGCCCCGGGGAGTTGGGAGGAGG - Intronic
905464387 1:38141663-38141685 CCCCATGGGGAGCTGTGAGCTGG + Intergenic
906078377 1:43068329-43068351 GCCCGCGGGGCGCTGGGCGCGGG + Intergenic
909433503 1:75615824-75615846 CGGCGAGGGGAGGAGGGAGCGGG + Intergenic
910408501 1:86914988-86915010 TACCGCGGGGGGCGGGGAGCGGG - Exonic
910981324 1:92961871-92961893 CAGCGCGGGGAGCCGGAAGCCGG - Intergenic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
912625907 1:111204374-111204396 GCCAGCGCGGAGCTGGGAGCGGG - Intronic
913222016 1:116667531-116667553 TGGAGCGGGGAGCGGGGAGCGGG - Intronic
913279860 1:117175374-117175396 CGCTGCTGGGTGCTGTGAGCCGG + Intronic
914350529 1:146835960-146835982 GGGAGCTGGGAGCTGGGAGCTGG - Intergenic
914428476 1:147599817-147599839 CCCTGCGGGAAGCTGGGGGCGGG + Intronic
915463535 1:156082892-156082914 CGCGGCAGGGAGCGGGGAGAGGG - Intronic
915587045 1:156849484-156849506 CTCTGCGGGGAGGTGGGGGCAGG + Intronic
915593618 1:156884173-156884195 CCCCGTGGGGGGCTGGGACCAGG + Intergenic
915626310 1:157115988-157116010 GGGGGCGGGGAGCTGGGAGGAGG + Intergenic
916890095 1:169106053-169106075 CCCAGCCGGGAGCTGGGAGGGGG + Intronic
920002251 1:202808003-202808025 AGGCGCGGGGGGCGGGGAGCCGG - Intronic
921189822 1:212699602-212699624 CGCCGCGGGGGGCGAGGAGGTGG - Intronic
921291752 1:213664089-213664111 TGCTGCAGGGAGCTGGGTGCAGG - Intergenic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
924561208 1:245156976-245156998 CGCCAGGGAGAGCTGGGAGGGGG - Intronic
924846465 1:247778396-247778418 CGTCGTGGGGTGCGGGGAGCAGG - Intergenic
1062969333 10:1634087-1634109 CGCAGAGGGCAGGTGGGAGCAGG - Intronic
1063429612 10:5977386-5977408 CGGGGTAGGGAGCTGGGAGCAGG - Exonic
1063458448 10:6201411-6201433 CGGCGCGGGGGGCGGGGTGCCGG + Intronic
1063864279 10:10347041-10347063 CTGCGCCGGGAGCTGAGAGCTGG + Intergenic
1064011844 10:11742275-11742297 CGCGGCGGGGAGCGGCGAGCCGG + Intergenic
1065274195 10:24068813-24068835 TTCCTCAGGGAGCTGGGAGCTGG + Intronic
1065407764 10:25388689-25388711 AGCCAGTGGGAGCTGGGAGCAGG + Intronic
1066220560 10:33334250-33334272 CGGGGCGGGCAGCTGGGAGCCGG + Intronic
1069588897 10:69630119-69630141 CGGCGCGGGGTGCTGGGGGTCGG - Intergenic
1069849841 10:71397508-71397530 CGCGTCGGGGAGCTCGGAGCGGG - Intronic
1069884749 10:71616496-71616518 CGCAGTGGGGTGCTGGGACCAGG - Intronic
1070653239 10:78253093-78253115 AGCTGCAGGGACCTGGGAGCGGG + Intergenic
1070694544 10:78552215-78552237 TTCACCGGGGAGCTGGGAGCTGG + Intergenic
1070736125 10:78865011-78865033 TGCAGCAGGGAGCTGGGACCTGG + Intergenic
1070752840 10:78974045-78974067 GGGGGCGGGGAGCTGGGAGGAGG - Intergenic
1071086562 10:81874305-81874327 CGCCGCGGCGGGCTGGGATTCGG - Intergenic
1072152683 10:92696111-92696133 GGCCGAGGGGAGCGGGGAGGTGG + Intergenic
1072189723 10:93069639-93069661 CCCAGAGAGGAGCTGGGAGCTGG + Intergenic
1072719814 10:97773349-97773371 GGGCGTGGGGAGCTGGGGGCTGG + Intergenic
1073098914 10:100997088-100997110 GGGCGCCGGGAGCTGGGAGCCGG + Intronic
1073099903 10:101000857-101000879 AGCTGCGGGGAGCTGGGGGAGGG - Exonic
1074301944 10:112240909-112240931 CGCTGGTGGGAGCTGGGAACAGG - Intergenic
1074432270 10:113404166-113404188 CAGAGCTGGGAGCTGGGAGCTGG + Intergenic
1074454059 10:113582137-113582159 TGCCGCTGGGAGCAGGGACCAGG + Intronic
1075801766 10:125159155-125159177 CGCCGCGGAGGGCTGGGAGGAGG + Intronic
1076756509 10:132575364-132575386 AGCTGCGGGGGGCTGGGAGCAGG - Intronic
1076839533 10:133039212-133039234 CGCCGGGGGGAGGCTGGAGCTGG + Intergenic
1076840816 10:133044272-133044294 AGAAGCTGGGAGCTGGGAGCGGG - Intergenic
1076981899 11:209052-209074 CGCGGCGGGGTGCGGGGGGCAGG + Intronic
1076999604 11:316011-316033 GGCCGCGGGGAGGTGAGAGGCGG + Intergenic
1077320289 11:1937993-1938015 AGCCGGGAGGAGCTGGGTGCGGG - Intronic
1077384305 11:2261798-2261820 CCCGGTGGGGTGCTGGGAGCTGG - Intergenic
1078256540 11:9663784-9663806 CACTGCGGGGCGCTGGGAGGAGG + Intergenic
1079725067 11:23870351-23870373 AGCCCAGGGAAGCTGGGAGCGGG + Intergenic
1081807904 11:45900173-45900195 CGGCGCGGGGAGCCGGTTGCAGG + Exonic
1081870474 11:46380755-46380777 CTCCGCGGGAAGCGGGAAGCCGG - Exonic
1081909938 11:46694298-46694320 CACCCTGGGGAGCTGGGAGTTGG - Intronic
1083849198 11:65355350-65355372 CGCCGCTGGGGGGTGGGAGGTGG - Intronic
1083927635 11:65818200-65818222 CGCCCGAGGGAGCTGAGAGCTGG + Intergenic
1084113887 11:67030744-67030766 CTCAGCAGGGAGATGGGAGCTGG + Intronic
1084174371 11:67415841-67415863 CGCCGCGGGGAGCGGGCGCCCGG - Intronic
1084310307 11:68312798-68312820 CGCCGCGGGTAGGTGGGCGCAGG + Exonic
1085045370 11:73349688-73349710 AGCAGTGGAGAGCTGGGAGCAGG + Intronic
1085284615 11:75351690-75351712 CGGAGCAGGGAGCCGGGAGCGGG - Exonic
1085299894 11:75451621-75451643 CGCCGGGGGCAGCCGGGAGAAGG - Intronic
1085322522 11:75583649-75583671 CGCCGCGAGGGGCAGGGAGTCGG - Intergenic
1085711308 11:78831338-78831360 AGGAGCTGGGAGCTGGGAGCTGG - Intronic
1085711312 11:78831345-78831367 CCCGGCCAGGAGCTGGGAGCTGG - Intronic
1087175295 11:95090176-95090198 CGCCGCCGGGCGCAGGGCGCGGG - Exonic
1089339838 11:117749819-117749841 CAGCGGGGAGAGCTGGGAGCGGG + Intronic
1089589976 11:119533787-119533809 CCCCCCAGGCAGCTGGGAGCAGG + Intergenic
1089615335 11:119691840-119691862 GACAGCCGGGAGCTGGGAGCAGG - Intronic
1089744806 11:120609206-120609228 CACCTCGGGGATCTGGGTGCAGG + Intronic
1090189375 11:124758561-124758583 CCGCGGGCGGAGCTGGGAGCCGG - Intronic
1090293810 11:125569288-125569310 CGCCAGGCGGAGTTGGGAGCCGG + Exonic
1090817719 11:130314264-130314286 CGCCGAAGGGAGCGGAGAGCCGG - Intronic
1091157396 11:133386453-133386475 CGTTGTTGGGAGCTGGGAGCTGG - Intronic
1091275980 11:134350486-134350508 TGCCGCTGGGAGATGGGAGAGGG + Intronic
1091903605 12:4165055-4165077 GGGCGCGGGGAGCTGGGCTCGGG - Intergenic
1092747450 12:11687245-11687267 GGGCGTGGGGAGCGGGGAGCCGG - Intronic
1095431950 12:42144371-42144393 GGGCGCGGGGCGCTGGGCGCGGG - Intronic
1095465508 12:42484097-42484119 CGCGGGCGGGAGCGGGGAGCTGG - Intronic
1095986470 12:48002839-48002861 AGCTGCGAGGAGCCGGGAGCAGG - Intronic
1096096396 12:48938420-48938442 GGCCGGGGGGAGCGGGGAGGGGG - Exonic
1096111493 12:49031706-49031728 CTCAGTGGGAAGCTGGGAGCTGG + Exonic
1096842146 12:54385919-54385941 CACAGCTGGGGGCTGGGAGCTGG + Intronic
1101592882 12:106139126-106139148 GGCCGCCGTGAGCTGGGAGGGGG + Exonic
1102300357 12:111766893-111766915 TGCCGCGCGGGGCGGGGAGCGGG + Intronic
1103433003 12:120904052-120904074 CGCCCCGGGGCCCAGGGAGCGGG - Exonic
1103781135 12:123399420-123399442 CGCAGAGGGAAGCTGGGACCAGG - Intronic
1104929240 12:132329459-132329481 CGCCCCGGGGAGCGGTGAGGGGG + Intergenic
1104969874 12:132526491-132526513 CCCCTCTGGCAGCTGGGAGCTGG + Intronic
1104981518 12:132575007-132575029 CCCCGCGGGCAGCTCGGTGCAGG + Intronic
1105418422 13:20232424-20232446 CGCCCCGGGTAGGTGGGGGCGGG - Intergenic
1106231035 13:27821191-27821213 CGCCATGGGGCGCTGGGTGCTGG + Intergenic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1106576362 13:30979163-30979185 CCCCGCTGGGAGATTGGAGCGGG + Intergenic
1107699946 13:43037061-43037083 AGCTGCCGGGAGCTGGGAACAGG - Intronic
1109047980 13:57437895-57437917 CGCAGCTGGGAGGTGGGAGGTGG - Intergenic
1113914705 13:113863472-113863494 CGCCGCGCGGAGCTGGGGGGCGG + Intronic
1114674210 14:24430138-24430160 CGCGCCCGGGAGCGGGGAGCGGG + Intronic
1118744356 14:68763115-68763137 AGCAGCCGGGAGGTGGGAGCTGG + Intergenic
1119460519 14:74798701-74798723 CACCCCGAAGAGCTGGGAGCAGG + Exonic
1119480672 14:74955797-74955819 CGGCCCGGGGAGCTGCGGGCTGG - Intergenic
1119725617 14:76920356-76920378 GGCATCGGGGAGCTGGGAGGAGG - Intergenic
1121668494 14:95690812-95690834 CACGGCGGGCAGCTGGGAGAAGG - Exonic
1122268254 14:100556741-100556763 CGCAGCTGGGAGCTCAGAGCTGG - Intronic
1122621031 14:103057682-103057704 GCCCGCCGGGAGCAGGGAGCCGG - Intergenic
1122776210 14:104117975-104117997 CGCTCCGGGGAGCCGGCAGCGGG - Intergenic
1122905747 14:104800752-104800774 GGCCGCGGGGAGCGGGGAGAGGG - Intronic
1122910669 14:104826413-104826435 CGCCGCAGAGAGCTTGGGGCTGG - Intergenic
1123174323 14:106402073-106402095 ATCCGCGGGCAGCTGGGACCAGG + Intergenic
1123182535 14:106483008-106483030 ATCCGCGGGCAGCTGGGACCAGG + Intergenic
1202944368 14_KI270726v1_random:13721-13743 ATCCGCGGGCAGCTGGGACCAGG - Intergenic
1123721638 15:23066209-23066231 GGCCGCTGGGAGCTGAGACCGGG - Intergenic
1124318655 15:28694278-28694300 GGCCACGGGGAGCTGAGACCGGG - Intergenic
1124373670 15:29117182-29117204 GGCCCAGAGGAGCTGGGAGCCGG + Exonic
1124597349 15:31102084-31102106 TGCCCCGGGGAGCTGGGAGAAGG + Intronic
1124956955 15:34366398-34366420 AGCCTAGGGGAGCTGGGAGGTGG - Intronic
1125500621 15:40238569-40238591 CGCTCCGGGGAGCTGGCAGGGGG + Intergenic
1127930994 15:63597496-63597518 CACGTCGTGGAGCTGGGAGCAGG - Exonic
1128264307 15:66253699-66253721 GGCCGCGAGCAGCCGGGAGCCGG + Exonic
1128611070 15:69074158-69074180 CGCGGTGGGGAGCCCGGAGCAGG + Intergenic
1129255783 15:74333224-74333246 GACCCCGGGGAGTTGGGAGCAGG + Intronic
1129691802 15:77717995-77718017 AGGCCCAGGGAGCTGGGAGCAGG + Intronic
1130978121 15:88792780-88792802 CTCCGGGGGGAGCTTCGAGCTGG - Intergenic
1131515333 15:93073098-93073120 CGCCGGCGGGAGCAGCGAGCCGG + Intronic
1131605823 15:93901253-93901275 GGGCGGGGGGAGCTGGGAACAGG - Intergenic
1131971427 15:97897337-97897359 TGCCACGGGGGGCTGTGAGCTGG - Intergenic
1132973725 16:2701358-2701380 CCCTGCGGGGTGCTGGGAGGTGG + Intronic
1133219953 16:4315746-4315768 GGCCGCGGGGAGCGGGCACCGGG - Intronic
1133347174 16:5078798-5078820 CGGAGCGGGATGCTGGGAGCGGG + Exonic
1133562716 16:6964841-6964863 CACAGCAAGGAGCTGGGAGCAGG - Intronic
1133845137 16:9446524-9446546 GGTCCAGGGGAGCTGGGAGCGGG + Intergenic
1134490887 16:14694433-14694455 GGCCGCGGGGCGCTGGGGACAGG + Exonic
1134496268 16:14733551-14733573 GGCCGCGGGGCGCTGGGGACAGG + Intronic
1135003752 16:18800909-18800931 CACCGTGGGGAACCGGGAGCGGG - Intronic
1136003576 16:27313878-27313900 CGGGGCGGGGAGCAGGAAGCCGG + Intronic
1136154532 16:28374279-28374301 GGCCGCGGGGCGCTGGGGACAGG - Intergenic
1136208559 16:28740985-28741007 GGCCGCGGGGCGCTGGGGACAGG + Intergenic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1137665266 16:50246031-50246053 CGGGGCGGGGGGCTGGGGGCTGG - Intergenic
1139391996 16:66610984-66611006 TGCTGCGGGCAACTGGGAGCAGG - Intronic
1139420164 16:66844890-66844912 CGCCGCGGAGCGCTGTGCGCGGG + Intronic
1139526792 16:67521658-67521680 CTCCAGGGGGAGCTGTGAGCTGG - Intronic
1141452748 16:84116738-84116760 CGCCGCCGGGAGCTCAGGGCCGG + Exonic
1141624721 16:85255110-85255132 CCCCTCGGGGAGCCGGAAGCTGG - Intergenic
1141701375 16:85643764-85643786 GACAGTGGGGAGCTGGGAGCAGG - Intronic
1142002677 16:87672356-87672378 CTCAGCGGGGGTCTGGGAGCAGG - Intronic
1142196887 16:88743120-88743142 GGCCACAGGCAGCTGGGAGCAGG - Intronic
1142359832 16:89620780-89620802 AGTCTCGGGGAGCGGGGAGCCGG + Intronic
1142409138 16:89907540-89907562 GGCAGCTGGGAGCTGGGAGATGG - Intronic
1203141965 16_KI270728v1_random:1772565-1772587 CGGCCGGGGGAGCTGGGGGCCGG - Intergenic
1142474505 17:181166-181188 GGCCGCGCGGGGCTGGGACCCGG + Exonic
1142586930 17:979714-979736 CGCCGCGCGGACCGTGGAGCGGG - Exonic
1142697697 17:1643069-1643091 CGCGGCGGGGCGCCGGGAGGAGG - Intronic
1142697900 17:1643710-1643732 CGCGGCGGCGCGCTGCGAGCAGG - Exonic
1142699243 17:1649420-1649442 CTCCGCAGGGAGCTGCGCGCGGG - Exonic
1142989971 17:3723946-3723968 CGCTCCCGGGACCTGGGAGCCGG + Exonic
1143496869 17:7317460-7317482 GACCGAGGGGAGCTGGGAGCAGG - Exonic
1143520276 17:7440654-7440676 CCCTTAGGGGAGCTGGGAGCGGG - Intronic
1143875163 17:9985810-9985832 CGCCGTGGGGAGCTCTGAGCTGG - Intronic
1144671686 17:17136405-17136427 TCCCGCAGGGAGCTGGCAGCAGG - Exonic
1145980116 17:29006063-29006085 CGCCGAGCGGGGCTGGGGGCGGG + Exonic
1146143371 17:30388660-30388682 AGTCGGCGGGAGCTGGGAGCTGG - Intronic
1146723903 17:35142204-35142226 CGCCGCGGGGCGCTAGGGCCCGG - Intronic
1146790275 17:35747052-35747074 CCCCGCAGGGAACGGGGAGCAGG - Exonic
1147156373 17:38546377-38546399 AGCCGTGGGGAGATGGGAGGGGG + Intronic
1147312836 17:39605338-39605360 CGGCGCCGGGCGCGGGGAGCGGG - Exonic
1147336688 17:39730480-39730502 GGCCGCGATGAGCGGGGAGCCGG - Exonic
1147440341 17:40443692-40443714 GGGCGCGGGGCGCTGGGCGCAGG - Exonic
1147662649 17:42125237-42125259 CCCAGCAGGGAGGTGGGAGCGGG + Intronic
1147971250 17:44219942-44219964 CGCGGGGGGCAGCTGGGAGGAGG + Intronic
1148180660 17:45602304-45602326 CGGCGCGGGGAGCCGGTTGCAGG - Intergenic
1148183044 17:45620513-45620535 GGCCGCGGGGCCCGGGGAGCGGG + Intergenic
1148265809 17:46225178-46225200 GGCCGCGGGGCCCGGGGAGCGGG - Intronic
1148268243 17:46243620-46243642 CGGCGCGGGGAGCCGGTTGCAGG + Intergenic
1148899447 17:50865667-50865689 CGCCCCGGGCTCCTGGGAGCCGG + Intronic
1149610672 17:57955793-57955815 CTCCGCGGGGAGCTAAGAGCAGG + Intergenic
1150489040 17:65561771-65561793 GGCCGCGGGGGGCTGGCAGGGGG - Intronic
1150520891 17:65865937-65865959 AGCCGGTGGGAGCTGGGAGCAGG + Intronic
1150640157 17:66944230-66944252 GGCAGCGGGGAGCTGGGACCAGG - Intergenic
1150654376 17:67030436-67030458 GGAAGCGGGGAGCGGGGAGCGGG - Intronic
1151828706 17:76537604-76537626 GGGCGCGGGGCGCCGGGAGCCGG + Exonic
1152069815 17:78128860-78128882 CGCCGCGGGGCGCCCGGAGGAGG - Intronic
1152087984 17:78231944-78231966 GGGCGCGCGGAGCCGGGAGCCGG - Exonic
1152157323 17:78643491-78643513 TGCTGCGGGGAGCTAGGGGCTGG - Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152697508 17:81804337-81804359 GGGCGCGGGGAGCGGGGAGCCGG + Intronic
1153031031 18:712774-712796 CGCCCCCGGGAGCCCGGAGCTGG - Intergenic
1153935288 18:9914809-9914831 CGCCGCTGACAGCCGGGAGCGGG - Intronic
1157412897 18:47478663-47478685 GGCAGCCGGGTGCTGGGAGCTGG - Intergenic
1157529227 18:48408139-48408161 GGCCGAGGGGAGCTGGGGGTGGG - Intronic
1160100698 18:75916906-75916928 TGGCTCTGGGAGCTGGGAGCTGG - Intergenic
1160242528 18:77133315-77133337 CTCCTCTGGGAGCTGGGAGCTGG + Intronic
1160242531 18:77133322-77133344 GGGAGCTGGGAGCTGGGAGCTGG + Intronic
1160592359 18:79951594-79951616 GGACGCGGGGCGCTGGGCGCGGG - Exonic
1160718666 19:588335-588357 CGCGGCTGGGAGCAGGGAGGAGG - Intergenic
1160823214 19:1067724-1067746 GGCCGCGGGGCCCAGGGAGCAGG + Intronic
1160877723 19:1304957-1304979 CGCCGCGGGCAGGGGGCAGCGGG + Intergenic
1160954628 19:1684920-1684942 AGCCGTCAGGAGCTGGGAGCCGG + Intergenic
1161033481 19:2071132-2071154 GGGCTCGGGGAGGTGGGAGCAGG - Exonic
1161627967 19:5338100-5338122 TCCCGCGGGGAGTGGGGAGCGGG + Intronic
1161965005 19:7542935-7542957 AGCCGAGGGGAGCTGGGCACAGG + Intronic
1161984043 19:7644283-7644305 AGCCTCGGAGAGCTGGGACCTGG + Intronic
1162374488 19:10296618-10296640 GCCCGCGGGGAGAGGGGAGCGGG - Exonic
1162435389 19:10654828-10654850 AGCCGCGGGGAGGCGGCAGCCGG - Intronic
1162744608 19:12791518-12791540 GCCAGCAGGGAGCTGGGAGCTGG + Exonic
1162914070 19:13865167-13865189 CGGCGCGGGGAGGAGGGAGGGGG + Intronic
1164394528 19:27851418-27851440 TGCAGCGGGGAGCTGGGTTCGGG + Intergenic
1164639197 19:29812201-29812223 CGCGCCGGGGAGCTGGGTGGGGG + Intronic
1164884550 19:31767402-31767424 GGCAGCTGGCAGCTGGGAGCTGG + Intergenic
1165154176 19:33777423-33777445 CGCCCCGGGGAGCAGGGTGTGGG + Intergenic
1165326492 19:35117201-35117223 GGCTGCAGGGAGCCGGGAGCTGG - Intronic
1165940707 19:39413508-39413530 CGCCGGCGGGAGTTGGGGGCTGG + Intronic
1166432905 19:42741719-42741741 CCCCCCGGGGTGCAGGGAGCAGG + Intronic
1167074388 19:47239911-47239933 CGGCGCGGGGGGCGGGGAACCGG + Intergenic
1167508164 19:49882030-49882052 TCCTGCGGGGAGCTGGGAGGCGG - Exonic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1168333837 19:55585858-55585880 CGAGGCGGGGAGCCGGGAGGAGG + Intergenic
925157520 2:1658825-1658847 AGCCGCGGGGAGATGGGGGGTGG - Intronic
925917818 2:8619308-8619330 CGCCCCGGGGCCCAGGGAGCAGG + Intergenic
926175485 2:10587873-10587895 CTGCACGGAGAGCTGGGAGCTGG + Intronic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
927423426 2:22955999-22956021 CACCGTGCGGAGCTGGGTGCTGG + Intergenic
927472666 2:23386772-23386794 CGGAGCGCGGGGCTGGGAGCCGG + Intronic
927794121 2:26033761-26033783 TGTCCCGGGGAGCGGGGAGCGGG + Intergenic
928205693 2:29281715-29281737 CTCAGCGGGGATCTGGGAGGTGG + Intronic
929548716 2:42875375-42875397 CGCCGGGAGGAGGAGGGAGCTGG - Intergenic
929983187 2:46699483-46699505 CGGCGCGGGGGCCGGGGAGCAGG - Intronic
930712006 2:54558373-54558395 CGCCGCGGGCAGCTGGGAGGAGG + Intronic
930762041 2:55049045-55049067 CACCCCGGGGAGCTGGGCGGTGG + Intronic
931722577 2:65078102-65078124 CGACGCGTGGAGCTGGCAGATGG - Intronic
931763606 2:65436209-65436231 CGCCTCGCGGGGCGGGGAGCGGG - Intergenic
932699987 2:73985448-73985470 CGCCGAGGGGCGCGGGGAGGGGG - Intergenic
933065696 2:77792796-77792818 CGACGAGGCGAACTGGGAGCTGG - Intergenic
934656019 2:96117058-96117080 GGGAGCGGGGAGCGGGGAGCCGG + Intergenic
934751561 2:96797293-96797315 GGCCGGGGTGAGCAGGGAGCAGG + Intronic
934989994 2:98914280-98914302 TGCTGTGGGGGGCTGGGAGCTGG - Intronic
934993273 2:98936175-98936197 TGCAGCTGGGAGCTGGGAGCTGG - Exonic
935336817 2:102023925-102023947 CGCCCCGAGGAGCTGGGACCCGG - Intronic
937206269 2:120238968-120238990 TGCAGCGGGGAGCGGGGAGCGGG - Intergenic
937221242 2:120344362-120344384 CGGCCCGGGGAGCTGGGTGAGGG + Intergenic
937996411 2:127697946-127697968 CCCCTTGGGGAGGTGGGAGCTGG + Intergenic
938062044 2:128261926-128261948 CTCAGCGTGGGGCTGGGAGCAGG + Intronic
938255736 2:129858544-129858566 CCCAGCTGGGCGCTGGGAGCAGG + Intergenic
939612926 2:144332280-144332302 CGGCGCGGGGAGCCGGGGGCGGG - Intronic
940316810 2:152335477-152335499 CGCGGCGGAGGGCGGGGAGCCGG + Exonic
940612338 2:156006964-156006986 AGCCGGCAGGAGCTGGGAGCAGG - Intergenic
940912971 2:159225161-159225183 CGCCGTGGGGACCTAGCAGCTGG + Intronic
943060437 2:183037750-183037772 CGCCGCCGGGAGCCGGGAAATGG + Intronic
943858290 2:192827892-192827914 AGCCGGTGGGAGCTGGGAACAGG + Intergenic
944173078 2:196800442-196800464 GGGCGCGGGGCGGTGGGAGCGGG - Intergenic
944215600 2:197252315-197252337 CGGGGCGGGTAGCGGGGAGCAGG - Intronic
944632766 2:201643443-201643465 CGTCGCGGGGAGCTGGGCTCGGG - Exonic
947611173 2:231526013-231526035 GGCCTTGGGGAGCTGGGGGCTGG - Intronic
947636665 2:231683773-231683795 CCCCGCAAGGAGCTGGGAGCAGG + Intergenic
947794381 2:232884991-232885013 CGCAGCGGGCAGGTGAGAGCAGG + Intronic
948109120 2:235440380-235440402 CGCCACGGGAGGCTGGGAGGTGG + Intergenic
948801402 2:240435219-240435241 CGCGGGAGGGAGCGGGGAGCGGG + Intergenic
948858293 2:240740821-240740843 CCCTGGGGGCAGCTGGGAGCTGG - Intronic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1170622652 20:18008378-18008400 AGCCGGAGGGTGCTGGGAGCAGG - Intronic
1170938954 20:20832976-20832998 AGCCACGAGGAGCTGGAAGCAGG + Intergenic
1172944097 20:38674562-38674584 CGCCCCGGGGCTCTGGGGGCGGG - Intergenic
1173025533 20:39304244-39304266 AGCCGAGGGGAGCTGAGAGAAGG + Intergenic
1174263970 20:49318393-49318415 GGCCACGGGGGCCTGGGAGCGGG + Intergenic
1175230215 20:57469192-57469214 CGCCCTGGGGAGTGGGGAGCTGG - Intergenic
1175575297 20:60056459-60056481 CAGAGTGGGGAGCTGGGAGCAGG + Intronic
1175929809 20:62488365-62488387 CCTCGCAGGGAGCTGGGAGGTGG + Intergenic
1175962134 20:62642558-62642580 GTGCGCGGGGAGCGGGGAGCTGG + Intronic
1176078322 20:63259286-63259308 CTCTGCGGGGAGCTGGCATCTGG - Intronic
1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG + Intronic
1176194480 20:63831012-63831034 CGGAGCCGGGAGCCGGGAGCCGG - Intronic
1178947254 21:36959001-36959023 AACCAGGGGGAGCTGGGAGCAGG + Intronic
1180342524 22:11629422-11629444 CAGCGCGGGGCGGTGGGAGCCGG - Intergenic
1181811288 22:25405187-25405209 CGCCGCAGGTAGGTGGGCGCGGG - Intronic
1181956266 22:26589889-26589911 CGGGGCTGGGAGCTGGGATCTGG - Intronic
1182011661 22:27006331-27006353 CCCCCCAGGGAGTTGGGAGCTGG + Intergenic
1182257382 22:29048967-29048989 AGCAGTGGGGAGTTGGGAGCGGG + Intronic
1182283505 22:29231365-29231387 GGTCGGGGGGAGCTGGGAGTGGG + Intronic
1182549691 22:31094092-31094114 GGCGGCAGGGAGCTGGGGGCTGG - Intronic
1182586124 22:31345290-31345312 GGCCGGGGGCAGCCGGGAGCTGG - Exonic
1183382975 22:37499723-37499745 CTCCGAGGAGTGCTGGGAGCAGG - Intronic
1183508097 22:38220473-38220495 CACAGTGGGGAGCTGGGAGGTGG - Exonic
1184256190 22:43288471-43288493 CGAGGCGGGGAGGTGGGGGCTGG - Intronic
1184412169 22:44331704-44331726 CGCGGCGCGGAGCTGGGGCCGGG + Intergenic
1184754810 22:46509740-46509762 GGCCTCAGGGAGCTGGGAGGAGG + Intronic
1184796774 22:46737729-46737751 CCCCGCGGGGAGGTGGGACCCGG - Intronic
949777948 3:7653001-7653023 CCAGGCGGGGAGCTGGAAGCAGG - Intronic
950264381 3:11563387-11563409 CACCCCGGGGAGCAGTGAGCGGG + Intronic
951558641 3:23945301-23945323 CGCCGCGGTGCGCTGGCTGCAGG + Exonic
952258533 3:31716437-31716459 GGCCTCGGGGAGCAGGGAGGAGG - Intronic
952861421 3:37815879-37815901 CTCTGCGGGCAGCTGGGAGTTGG + Intronic
953627110 3:44580323-44580345 TCCCGCAGGGAGCTGGCAGCAGG + Intronic
953996620 3:47524689-47524711 CGCAACCGGTAGCTGGGAGCCGG - Intergenic
954131964 3:48565444-48565466 CACAGCATGGAGCTGGGAGCCGG + Exonic
954265893 3:49470167-49470189 CGCCGCGCGGAGCTGGCCGCTGG + Exonic
954839059 3:53495292-53495314 CGCCGCGGGGAAGGGGGAGGGGG - Intronic
955412334 3:58663845-58663867 TGGAGCTGGGAGCTGGGAGCTGG - Intronic
961322335 3:126084283-126084305 GGGCCCGGGGGGCTGGGAGCCGG + Exonic
961400301 3:126636605-126636627 CGCCGTGGGGTGCAGGGAGGGGG - Intronic
961449304 3:126995292-126995314 CCACGGGAGGAGCTGGGAGCAGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
961574280 3:127822485-127822507 TGCCGGTGGGAGCTGGAAGCAGG - Exonic
961654400 3:128433287-128433309 CGCCGGGGGGAGGGAGGAGCGGG - Intergenic
963733038 3:148991324-148991346 CGCCCCGGGGAAGTAGGAGCAGG + Exonic
963939468 3:151085474-151085496 TGCAGCGGGGGGCTTGGAGCAGG + Intergenic
964570751 3:158105700-158105722 CGCCGAGAGAAGCAGGGAGCCGG - Exonic
967165125 3:186773354-186773376 CTTCGCGGGGAGCTGGGATTAGG - Intergenic
968035338 3:195543441-195543463 CCCCGCGCGGCGCTGGGAGGCGG + Intergenic
968143086 3:196274305-196274327 AGCCACTGGGAGCTGGGAGTAGG - Intronic
968173466 3:196528878-196528900 CTCCGCGGGGAGCTGGGCGGTGG + Intergenic
968473158 4:791173-791195 CGGGGCGGGGGGCGGGGAGCGGG + Intronic
968596614 4:1489342-1489364 CGCCCTGGGGAGGTGGGAGGCGG - Intergenic
968607994 4:1544615-1544637 CGCCACGGGGAGCTGGGGAGAGG + Intergenic
968695527 4:2024177-2024199 CTCCCTGGGGAGCTGAGAGCTGG + Intronic
969361208 4:6664810-6664832 AGCCGCTGGGCGCAGGGAGCGGG - Intergenic
969674669 4:8608143-8608165 CGCAGCTGGGGGCTGGGGGCTGG - Intronic
972312018 4:37890932-37890954 GTCCCCGGGGAGCTGGGAGGGGG - Intergenic
973137338 4:46724501-46724523 GGCGGCGGGGCGCTGGGTGCCGG + Intergenic
977809813 4:101346463-101346485 AGCCGCGGGGAGGTGGCGGCGGG - Intronic
978301145 4:107270536-107270558 AGCCAGTGGGAGCTGGGAGCGGG - Intronic
978576742 4:110196847-110196869 GCCCGCGGGAAGCTGGGAGTGGG + Intronic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
981093479 4:140756344-140756366 CGCCGCCGTGGGCCGGGAGCCGG - Intergenic
982107876 4:152026426-152026448 CCCCGGGGGGAGGGGGGAGCTGG + Intergenic
985549133 5:524385-524407 CGACGCGCGGGGCTGGGACCCGG + Intergenic
985867911 5:2529749-2529771 CTCCGAGAGGAGCTGGAAGCTGG - Intergenic
985997086 5:3602945-3602967 CGCGTCGGGGAGCGGGGAGTGGG + Intergenic
986813633 5:11385056-11385078 CGGCGCGGGCAGCGTGGAGCTGG + Exonic
989103265 5:37839471-37839493 CGGGCCGGGGAGCAGGGAGCGGG - Intronic
992550141 5:77851994-77852016 GGTGGCGGGGAGCCGGGAGCCGG - Intronic
993501827 5:88674503-88674525 GCCCGCGGGGAGCAGGGAGGCGG + Intergenic
994043612 5:95284649-95284671 CGCCGCGGGGACCCGGGAGGAGG - Intergenic
995512329 5:112921829-112921851 CGGCGCCGGGCGCTGGCAGCTGG - Intronic
996329430 5:122312307-122312329 CGCCGCGGGGAGGCGGGAGGCGG + Intronic
997470556 5:134114866-134114888 GGGCGCGGGGCGCTGGGCGCCGG - Exonic
997583857 5:135033643-135033665 GAGCACGGGGAGCTGGGAGCAGG - Intronic
997584093 5:135034444-135034466 GGCCGCGGGGGGCGGGGAGGCGG - Intronic
998588954 5:143456957-143456979 CCCTGCGGGGAGCTGTGAACTGG - Intergenic
999322576 5:150624646-150624668 GGCCCCGGGGAGCAGGCAGCAGG + Intronic
1001171363 5:169422501-169422523 TGCTCCAGGGAGCTGGGAGCTGG - Intergenic
1002001663 5:176199613-176199635 CGCGGAGGGGAGCGGGGCGCGGG + Intergenic
1002252675 5:177939370-177939392 CGCGGAGGGGAGCGGGGCGCGGG - Intergenic
1002312609 5:178323732-178323754 CGCTGCAGGGAGCAGGGAGGTGG + Intronic
1002418867 5:179135125-179135147 TGGAGCCGGGAGCTGGGAGCTGG - Intronic
1002578678 5:180193944-180193966 CGGCCCTGGGAGCTGGGAGACGG + Intronic
1004396346 6:15248834-15248856 CGGCGGGGGGAGGAGGGAGCTGG + Intronic
1004607255 6:17206387-17206409 GGCCGCGGGGGGAGGGGAGCAGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005683018 6:28225446-28225468 AGCCGCTGGGAAGTGGGAGCCGG + Intronic
1005826249 6:29633070-29633092 GGGAGCGGGGAGCGGGGAGCCGG + Exonic
1006179874 6:32148436-32148458 CGCCGAGGGGAGCGGGGAGCGGG + Exonic
1006187655 6:32190035-32190057 CCCCCGGGGGAGCCGGGAGCCGG - Exonic
1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG + Intergenic
1006871714 6:37257785-37257807 CGTCCCCAGGAGCTGGGAGCGGG + Exonic
1007558105 6:42783143-42783165 CGCCGCCGCGGGCTCGGAGCGGG - Intronic
1008109514 6:47477759-47477781 AGGTGCGGGGAGCTGGGACCGGG - Intergenic
1008956452 6:57221723-57221745 CACCGCTGGGAGCTGGGAGGGGG + Exonic
1013459014 6:110358003-110358025 CGCCGGGGGGCGGCGGGAGCGGG - Exonic
1015625872 6:135181001-135181023 CGCCGCCGCGACCCGGGAGCGGG + Intergenic
1015842319 6:137488828-137488850 CAGGGCGGAGAGCTGGGAGCCGG - Intergenic
1016314603 6:142771940-142771962 CTCCGCGGGGAGCTGGGAAAGGG + Exonic
1017103220 6:150866124-150866146 CGCCGTGGGGAGCGGGGCGCGGG + Intronic
1018030409 6:159837024-159837046 CCCTGCGGGGAGGTGGGGGCAGG - Intergenic
1018288083 6:162262645-162262667 CGCGGCGGGAGGCTGTGAGCGGG - Exonic
1018974537 6:168555117-168555139 GGCCGAGAGGAGCCGGGAGCTGG - Intronic
1019343345 7:518612-518634 AGCAGCGGGGTGCGGGGAGCGGG - Intronic
1019343481 7:519122-519144 TGGCGCGGGGAGCACGGAGCTGG + Exonic
1019479657 7:1260601-1260623 GGCCGCGGGGAGAGGGGAGGTGG - Intergenic
1019709514 7:2511833-2511855 CACGGCGGGGGGCTGGGAGGAGG - Intergenic
1019795180 7:3043639-3043661 CGCAGCGGGGATGGGGGAGCTGG - Intronic
1019949275 7:4358150-4358172 CCTCGCAGGGAGCTGGGCGCAGG + Intergenic
1020027210 7:4907572-4907594 CACCGAGGGCATCTGGGAGCTGG - Exonic
1020238503 7:6374621-6374643 GGCGGCGGGGCGCTGGGTGCCGG - Exonic
1021561516 7:21972524-21972546 CTCCTGGGGGAGCTGGGAACAGG - Intergenic
1021969354 7:25951365-25951387 GGCCGCGCGGGGCTGGGGGCGGG + Intergenic
1023876544 7:44289293-44289315 CTCCCCGGAGAGCTGGGAGGAGG + Intronic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1026833689 7:73624513-73624535 CGCTGCGCGGAGCAGGGACCAGG - Exonic
1026936977 7:74263174-74263196 CGACGTGGGGAGCCGGGAGGCGG - Intergenic
1026967243 7:74448038-74448060 TGCCAAGGGGACCTGGGAGCAGG - Intergenic
1027311938 7:76960002-76960024 CGCGGGGGGGCGCGGGGAGCCGG + Intergenic
1029456560 7:100675012-100675034 CGCCTGGGGGAAGTGGGAGCTGG + Intronic
1029458602 7:100683148-100683170 GGGGGCGGGGAGCTGGGTGCGGG + Exonic
1029550907 7:101236623-101236645 CTTAGCGGGGAGCAGGGAGCGGG + Intronic
1029552377 7:101244337-101244359 CGCCGCGGGGAGGGGAGACCGGG - Intronic
1032194067 7:129779818-129779840 CTCCGCGCGGAGCTGAGAGGCGG - Intergenic
1032201396 7:129825404-129825426 CTGTGCGGGGAGCGGGGAGCGGG - Intergenic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1032508331 7:132452595-132452617 GCCCCCAGGGAGCTGGGAGCTGG - Intronic
1034242983 7:149624181-149624203 CGCTGGGGGGAGCTGGGGGAGGG + Intergenic
1034560619 7:151877316-151877338 CGCGGCGGGGGGCGAGGAGCGGG - Intergenic
1034589681 7:152128846-152128868 GGGAGCGGGGAGCGGGGAGCGGG + Intergenic
1035580698 8:737834-737856 CGCCGGGGGCTGCCGGGAGCCGG + Intronic
1036767424 8:11557668-11557690 CCCAGCCGGGAGCTGGGAGTGGG - Intronic
1037450754 8:19013867-19013889 CGCCTCGGGGAGGGGGGAGGTGG + Intronic
1037769183 8:21789029-21789051 CGGCGCGGGGCGCGGGGCGCGGG + Intronic
1038627549 8:29208833-29208855 GGCCTGGGGGAGCTGGAAGCAGG - Intronic
1038798275 8:30727985-30728007 CGGGGCGGGGAACTGGGAGGCGG - Intergenic
1039454020 8:37696288-37696310 AGCCCCGGGGCGCTGGGAGCTGG - Intronic
1041621452 8:59974656-59974678 AGCCTCTAGGAGCTGGGAGCAGG + Intergenic
1042020574 8:64369407-64369429 GGCCGCGAGGAGCTGCGGGCCGG - Intergenic
1043372685 8:79612180-79612202 CGCGGCGGGGAGTCGGGAGCGGG - Intronic
1043845660 8:85160603-85160625 GGCCGCTGGGAGCTGGGGGTTGG + Intergenic
1044451666 8:92342778-92342800 GGCTGGGGGAAGCTGGGAGCAGG - Intergenic
1045111547 8:98942056-98942078 CGCCGAGGGCTGCTGGGGGCGGG + Intronic
1048008558 8:130438591-130438613 CGAGGCGGGGAGCTGGTAGAGGG + Intronic
1048484179 8:134832040-134832062 GGGCGCGGGGCGCTGGGAGCGGG - Intergenic
1048980795 8:139702623-139702645 CGCCGCGCCGGGCTGGGTGCAGG - Intronic
1049407781 8:142459329-142459351 AACCGAGGGGACCTGGGAGCTGG + Intronic
1049719329 8:144108370-144108392 CGCCGCCTGGAGGTGGCAGCCGG + Exonic
1051774519 9:20620556-20620578 CGGCGCGGGGGGCGGGGAGCGGG + Intronic
1054907088 9:70420956-70420978 CGGCGCCGGGAGATGGGGGCGGG - Intergenic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057490634 9:95517034-95517056 GGCCGCGGGGGGCGGGGAGAGGG - Intronic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058687142 9:107489138-107489160 AGGCGCGCGGCGCTGGGAGCAGG - Intronic
1058718388 9:107741967-107741989 GGCATCGAGGAGCTGGGAGCAGG - Intergenic
1059102373 9:111483439-111483461 CGCCGCGCGGTGCCGGGGGCCGG - Intronic
1060544314 9:124451357-124451379 CGCCCTGGAGAGCTGGGAGAGGG - Intergenic
1060740935 9:126097093-126097115 CGCCGTGGGGAGCTGAGATGGGG + Intergenic
1060883660 9:127135781-127135803 CGGCTCTGGGAGCTGGGAGGAGG - Intronic
1061100023 9:128485295-128485317 GGCTGCCAGGAGCTGGGAGCGGG - Intronic
1061127942 9:128688880-128688902 CTCCGCGGGGCACCGGGAGCGGG - Intronic
1061252806 9:129436566-129436588 CTCTGCGGGGAGCGGGGGGCGGG - Intergenic
1061306984 9:129737886-129737908 GGCCTCGGGGTGCTGGGAGGGGG + Intergenic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1061710881 9:132486951-132486973 TGCCCCGGGGAGCGGGGACCAGG + Intronic
1061996793 9:134190184-134190206 GGCTGCGGGGAGGTGGGAGGTGG - Intergenic
1062453334 9:136624630-136624652 AGCCCCCTGGAGCTGGGAGCTGG + Intergenic
1185778968 X:2829321-2829343 CGCGGCGGGGCGCGGGGAGACGG + Intronic
1188207640 X:27380290-27380312 GGGAGCTGGGAGCTGGGAGCTGG + Intergenic
1188756391 X:33968930-33968952 AGCCAGTGGGAGCTGGGAGCAGG + Intergenic
1189332878 X:40153926-40153948 CGCCGTGGGGGGCAGGGGGCGGG + Intronic
1195346458 X:103954821-103954843 AGCTGTGGGGAGCAGGGAGCAGG - Intronic
1195360990 X:104084015-104084037 AGCTGTGGGGAGCAGGGAGCAGG + Intergenic
1195668418 X:107450119-107450141 CGCCCCCGGGAGCCGGGGGCAGG + Intergenic
1197694891 X:129540291-129540313 GGGCGCCGGGAGCCGGGAGCGGG - Exonic
1197718553 X:129728212-129728234 GGTGGCGGGGAGCTGGGGGCTGG + Intergenic
1197745966 X:129932392-129932414 CGGGGCGGGGCGCTGGGACCTGG - Intergenic
1198767183 X:140091632-140091654 GGAGGCGGGGAGCTCGGAGCAGG + Intergenic
1200129048 X:153831028-153831050 CGGCGCGGGAAGCCGGGGGCGGG + Intergenic
1200138027 X:153884345-153884367 CTCAGCAGGGAGCTGGCAGCTGG + Intronic