ID: 922416638

View in Genome Browser
Species Human (GRCh38)
Location 1:225428135-225428157
Sequence CCCGGGCGGCCTCGCCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922416638_922416653 28 Left 922416638 1:225428135-225428157 CCCCACCGGCGAGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 922416653 1:225428186-225428208 TCATCCCCGGCGCTGTCGATTGG 0: 1
1: 0
2: 0
3: 1
4: 21
922416638_922416651 15 Left 922416638 1:225428135-225428157 CCCCACCGGCGAGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 922416651 1:225428173-225428195 TCGACCTTTTGAATCATCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922416638 Original CRISPR CCCGGGCGGCCTCGCCGGTG GGG (reversed) Intronic
900121322 1:1049779-1049801 CCCGCCCGGCCGCGTCGGTGAGG + Exonic
901279849 1:8025914-8025936 CCCGGGCTGCGCCGCCGGGGAGG + Intronic
902089578 1:13892858-13892880 CCCGCGCCGCCACCCCGGTGCGG - Intergenic
902690537 1:18107956-18107978 CCCGGGCTGCCTGGCCGCGGCGG + Exonic
903466288 1:23554654-23554676 CCAGGGCGGCCTCGCGGACGGGG + Intergenic
905314425 1:37072643-37072665 CCCGGGCAGCCTCCCTGATGTGG - Intergenic
905670815 1:39788953-39788975 CCCGGGCCCCCTCGCAGGCGTGG - Intergenic
906262864 1:44406809-44406831 CGTGGGCGGCCTCGCCCGGGGGG - Intronic
906627020 1:47333813-47333835 CCCGGGCAGCCACGGCGGCGGGG + Exonic
909958225 1:81802945-81802967 CCAGGGCGGCCTCGTGGGTCGGG + Intronic
919463240 1:197902936-197902958 CCGGGGCGGCCGCGGCGGGGCGG - Intronic
922416638 1:225428135-225428157 CCCGGGCGGCCTCGCCGGTGGGG - Intronic
924172599 1:241357312-241357334 CCCGGGAGGCCCGGGCGGTGTGG - Intergenic
1067572927 10:47384665-47384687 CCCGCGGGGCCTCGGCGATGCGG + Intergenic
1067685774 10:48465358-48465380 CCTGGGCTTCCTCTCCGGTGTGG - Intronic
1067769842 10:49115368-49115390 GCCGGGCGGCCGCGCCGGGGAGG - Intronic
1072562183 10:96586702-96586724 CCGGGGCGGCCGCGCCGGCCGGG + Intronic
1073268309 10:102241446-102241468 CCCGGGCCGCCTCTCCGCTCGGG + Exonic
1074137957 10:110644242-110644264 CCCGGCCGGCCACGCGGGGGCGG - Intergenic
1077442611 11:2575634-2575656 CCCTGGCTGCCTGGCCGGCGAGG - Intronic
1077491512 11:2862940-2862962 CCGGGGCGGCCCGGGCGGTGGGG + Intergenic
1078895275 11:15591983-15592005 CCAGGGCTGCCTCTCCGGTAGGG + Intergenic
1081871731 11:46385765-46385787 CCCGGGCGGCCTCCCCGGGCGGG + Exonic
1083658530 11:64241670-64241692 CCCGGGCGTCCTCGCGGGGGTGG + Intronic
1084090966 11:66879187-66879209 CCAGGACGGCCTGGCCTGTGGGG - Intronic
1091217632 11:133912894-133912916 CCTGGGCTGCCTCACGGGTGTGG - Intronic
1092163517 12:6329014-6329036 CCCGAGCAGCCTTGCTGGTGAGG + Exonic
1098161438 12:67649959-67649981 CGCGGGCGGCCCGGGCGGTGGGG + Intronic
1098996848 12:77130307-77130329 CCCGGGTGGCCTCACAGTTGAGG + Intergenic
1103091934 12:118103882-118103904 CCCGAGCGCCCTGGCCGGGGAGG + Exonic
1103317900 12:120071820-120071842 CCCAGGTAGCCTCGCCTGTGGGG - Intronic
1104916682 12:132269167-132269189 CCAGGGCGGCCTCAGCGCTGAGG + Intronic
1104925114 12:132309950-132309972 CCCGGGTGACCTCGCCGCTGAGG + Intronic
1105004309 12:132711306-132711328 CCAGGGCGGACTCGCAGGGGCGG - Intronic
1105203066 13:18195321-18195343 CCCGGGCAGCATCGGCGGCGTGG + Intergenic
1106517346 13:30466208-30466230 CTCCGGCGGCCGCTCCGGTGTGG - Intronic
1113655812 13:112067354-112067376 CCCAGGCGCCCTCGGCGGAGCGG - Intergenic
1113841770 13:113364742-113364764 CCAGGCCTGGCTCGCCGGTGGGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114455174 14:22849322-22849344 CCCGGGCAGCCTCACTGGGGTGG - Intergenic
1119171670 14:72540527-72540549 CCCTGGCAGTCACGCCGGTGTGG + Intronic
1121253010 14:92513636-92513658 CCCGGGCGGCCGCGCCCCCGGGG - Intergenic
1122904454 14:104795454-104795476 CCCGGGCGGCCACGGCGGGCGGG + Intronic
1122942043 14:104985848-104985870 CCCGCGCGGCCCCGCCGAGGCGG + Exonic
1122947767 14:105020998-105021020 GGCGGGCGGCCTCGCGGGTCAGG - Exonic
1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG + Exonic
1125811798 15:42548494-42548516 CCCGGTCGGCCTCCCGGCTGGGG + Exonic
1128068002 15:64776009-64776031 CCCGGGCGGCCTCGCGCTTAGGG + Intergenic
1129162262 15:73753256-73753278 CCCGGGCGGCCAGTCCGGCGGGG - Intergenic
1131827042 15:96330475-96330497 CGCGAGCGGCGTCGCCGGCGCGG - Intronic
1132460841 16:53802-53824 GCTGGGCGGCCTCGCTGGGGCGG + Intronic
1132641608 16:980872-980894 CCAGGGCCGCCCCGCCGGAGGGG + Intronic
1133156391 16:3879946-3879968 CACGGGCGGCCGGGCCGGCGAGG + Exonic
1133198046 16:4184527-4184549 CCCGGGCGGCCAGGCCGATGGGG + Intergenic
1133732588 16:8589805-8589827 CCTGGGCGGGCTGGCCGGCGCGG - Exonic
1138179738 16:54933225-54933247 CCGGGGAGGGCCCGCCGGTGCGG - Exonic
1141475546 16:84270706-84270728 CCAGGGTGGCCTCGCCCATGAGG + Intergenic
1142421267 16:89972117-89972139 CCCGCGCGGCCTCCTCGGAGTGG - Exonic
1142780645 17:2178824-2178846 CCTCGGCGGCCTCCCTGGTGCGG + Intronic
1143452220 17:7042924-7042946 CCTGGGCCTCCTCGCTGGTGAGG - Exonic
1146646815 17:34581559-34581581 CCCGGGCGCGCAGGCCGGTGCGG + Intronic
1147657393 17:42098545-42098567 CCCTCGAGGCCCCGCCGGTGGGG + Intergenic
1152714363 17:81891436-81891458 CCAGGGCGGCCGCGGCGGTGGGG - Exonic
1153900607 18:9614496-9614518 CCCGGGCGGCCGCGGAGGAGGGG - Exonic
1154194267 18:12254377-12254399 CCCGGGCGGCCTCCATGGCGCGG - Exonic
1160452453 18:78974532-78974554 GCCGGGTGGGCTCGCCGGCGTGG - Intergenic
1160698533 19:495817-495839 CCCGGGCGGCCGCACAGGGGCGG - Intronic
1160913722 19:1487155-1487177 GCCGGAAGGCCTCGCGGGTGAGG + Exonic
1161153335 19:2720771-2720793 CCAGGGCCGCCTGGCCGGTGAGG + Intronic
1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG + Exonic
1163423136 19:17226337-17226359 GCCGGACGGCCTTGCAGGTGGGG + Intronic
1163442624 19:17329369-17329391 CCCGTGGGTCCTCGCCGGGGTGG - Intronic
1168113360 19:54207480-54207502 CCCGGGCGGCCACCCCCGTAGGG - Exonic
927520633 2:23696126-23696148 CCCGGGGGGCCTCACCTGAGAGG - Exonic
927591244 2:24360126-24360148 CCCTGGCGGGCTCGGCCGTGCGG - Intronic
930189237 2:48440918-48440940 CCTGGGCGGCCTGGCCTGTACGG + Exonic
933858495 2:86441628-86441650 CCCGGGCGGCCCCACGGGGGAGG - Intronic
939969666 2:148644971-148644993 CCCGGGCGGCGGCGGCGGGGCGG - Exonic
942451230 2:176108836-176108858 CCCGGGCGGGCGGGCGGGTGGGG + Intronic
942890494 2:180981011-180981033 CCGGGGCGGCGGCGGCGGTGGGG + Intronic
1169557569 20:6767517-6767539 CCCGGGCAGCCGCGGCGGGGTGG - Intergenic
1175399704 20:58693229-58693251 CCCAGGCCCCGTCGCCGGTGCGG + Intronic
1176549078 21:8213728-8213750 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1176556972 21:8257948-8257970 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1176568010 21:8396766-8396788 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1176575914 21:8440985-8441007 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1176714894 21:10342684-10342706 CCCGGGCAGCATCGGCGGCGTGG - Intergenic
1178975861 21:37220815-37220837 CCTGGGCCGCCTGTCCGGTGCGG - Intergenic
1179553652 21:42159230-42159252 CCCTGGCTGCCTCGTTGGTGGGG + Intergenic
1180109726 21:45642445-45642467 CCCGCGGGTCCTCGCCGGGGTGG - Intergenic
1180603454 22:17037254-17037276 CCCGGGCAGCATCGGCGGCGTGG + Intergenic
1180699569 22:17774155-17774177 CCCGGGCGCCCTCCTCGGCGCGG - Intronic
1180891258 22:19291163-19291185 CCAGGGCGGCTTCGCCTGGGAGG - Intronic
1181085494 22:20437716-20437738 CCCGGGGGGCCGGGCCGGCGCGG - Exonic
1183370146 22:37427521-37427543 CCCGGGCGCCCTCCCCGCCGAGG - Intergenic
1184171752 22:42764261-42764283 CCCGGCCAGCCTCACTGGTGTGG + Intergenic
1203253965 22_KI270733v1_random:130043-130065 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1203262021 22_KI270733v1_random:175122-175144 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
949480987 3:4493576-4493598 CCCGGGGAGCCACGCCGGTTTGG - Exonic
961682535 3:128608550-128608572 CCCTGCCGGCCTCGCAGGCGTGG + Intergenic
964358323 3:155870470-155870492 CCCGGCCGGCTTTGCCGGCGGGG + Intergenic
968225553 3:196969916-196969938 ACCCGGTGGCCTCGCCGCTGCGG + Intergenic
968656893 4:1782596-1782618 CCCAGGCGGGCACGCCTGTGGGG - Intergenic
968820213 4:2844137-2844159 CCCGGGCAGCCTCGGGGGCGGGG + Intronic
969330271 4:6470783-6470805 CCCGGGCCTCCGGGCCGGTGGGG - Intronic
970394849 4:15655407-15655429 CCCGGTCGGCTTGGCCGGCGGGG + Exonic
972543123 4:40056637-40056659 CCCGGGCCGCCGCGCCGAGGCGG + Intergenic
981429833 4:144645984-144646006 CCCCGGCGGCCTCCCTGCTGCGG - Intergenic
983940611 4:173531353-173531375 CCCGGGCCGCAGCGCCCGTGTGG + Intergenic
1002927877 6:1615121-1615143 CCCAGGCGGCCTCCCCGGCAGGG + Intergenic
1003921644 6:10838407-10838429 CCCGGCCAGCCTCGCAGGTCGGG + Exonic
1010236682 6:73580490-73580512 CCCGGGCGGCGCAGCGGGTGAGG - Intergenic
1010774500 6:79869713-79869735 CCCAGGTGGCCTGGGCGGTGCGG + Intergenic
1014818159 6:125957237-125957259 GCAGGGAGGCCTCGCCGTTGTGG + Intronic
1019279546 7:192973-192995 CCCGCTCGGCCTCTCCGGAGCGG - Exonic
1020245246 7:6424424-6424446 CCCGGGAGGGCTCCCGGGTGTGG + Intronic
1024043820 7:45574460-45574482 CGCGGGCGGCGGCGCCGGGGCGG - Intronic
1033288627 7:140062820-140062842 CCAGGCCGGCGTCGTCGGTGAGG - Exonic
1036789450 8:11708510-11708532 CTCGGGCGGCAGCTCCGGTGGGG + Exonic
1037402020 8:18503202-18503224 CCCAGGCAGCCTCGTCGGGGTGG - Intergenic
1037829035 8:22177391-22177413 CCCGGGCAGCCTCTAGGGTGGGG + Intronic
1038008788 8:23457551-23457573 CCCGGCCGGCCAAGCAGGTGAGG - Exonic
1048833453 8:138497353-138497375 CCCGGGCGGCCGAGCGGGCGGGG - Intergenic
1049177947 8:141205819-141205841 CCCGGGCGGCCACCGGGGTGCGG + Intergenic
1049673026 8:143878123-143878145 CCCTGGCCGCCTCTCCCGTGAGG + Intronic
1057146775 9:92764219-92764241 CCTGGGCGGCCCCGGCGGGGCGG - Intronic
1058908159 9:109498083-109498105 CGCGGGCGGGCTGGCGGGTGCGG - Intronic
1203470365 Un_GL000220v1:113187-113209 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1203478186 Un_GL000220v1:157159-157181 CCCGCGCCGCCCCGCCGGAGCGG - Intergenic
1197981000 X:132217924-132217946 CCCCGGCGGCCGGGCGGGTGCGG - Exonic
1199772706 X:150984311-150984333 CCCGGGCGGCCCGGGCGGGGCGG + Intronic
1199996589 X:153030147-153030169 CGTGGGCGGCCTCCCCAGTGAGG + Intergenic
1200118831 X:153781035-153781057 CCCGGGCGGCTGCTCCTGTGGGG - Exonic