ID: 922417606

View in Genome Browser
Species Human (GRCh38)
Location 1:225435864-225435886
Sequence ACTTAATGGGGAGAGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922417606_922417610 26 Left 922417606 1:225435864-225435886 CCTTGTATCTCTCCCCATTAAGT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922417606 Original CRISPR ACTTAATGGGGAGAGATACA AGG (reversed) Intergenic
No off target data available for this crispr