ID: 922417607

View in Genome Browser
Species Human (GRCh38)
Location 1:225435876-225435898
Sequence ACACATTCATTTACTTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922417607_922417611 22 Left 922417607 1:225435876-225435898 CCCCATTAAGTAAATGAATGTGT No data
Right 922417611 1:225435921-225435943 ATGTTCTCCTAAAGGTCAGAAGG No data
922417607_922417610 14 Left 922417607 1:225435876-225435898 CCCCATTAAGTAAATGAATGTGT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922417607 Original CRISPR ACACATTCATTTACTTAATG GGG (reversed) Intergenic
No off target data available for this crispr