ID: 922417608

View in Genome Browser
Species Human (GRCh38)
Location 1:225435877-225435899
Sequence AACACATTCATTTACTTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922417608_922417610 13 Left 922417608 1:225435877-225435899 CCCATTAAGTAAATGAATGTGTT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data
922417608_922417611 21 Left 922417608 1:225435877-225435899 CCCATTAAGTAAATGAATGTGTT No data
Right 922417611 1:225435921-225435943 ATGTTCTCCTAAAGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922417608 Original CRISPR AACACATTCATTTACTTAAT GGG (reversed) Intergenic
No off target data available for this crispr