ID: 922417609

View in Genome Browser
Species Human (GRCh38)
Location 1:225435878-225435900
Sequence GAACACATTCATTTACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922417609_922417610 12 Left 922417609 1:225435878-225435900 CCATTAAGTAAATGAATGTGTTC No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data
922417609_922417611 20 Left 922417609 1:225435878-225435900 CCATTAAGTAAATGAATGTGTTC No data
Right 922417611 1:225435921-225435943 ATGTTCTCCTAAAGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922417609 Original CRISPR GAACACATTCATTTACTTAA TGG (reversed) Intergenic
No off target data available for this crispr