ID: 922417610

View in Genome Browser
Species Human (GRCh38)
Location 1:225435913-225435935
Sequence TGTCATATATGTTCTCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922417606_922417610 26 Left 922417606 1:225435864-225435886 CCTTGTATCTCTCCCCATTAAGT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data
922417607_922417610 14 Left 922417607 1:225435876-225435898 CCCCATTAAGTAAATGAATGTGT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data
922417608_922417610 13 Left 922417608 1:225435877-225435899 CCCATTAAGTAAATGAATGTGTT No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data
922417609_922417610 12 Left 922417609 1:225435878-225435900 CCATTAAGTAAATGAATGTGTTC No data
Right 922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922417610 Original CRISPR TGTCATATATGTTCTCCTAA AGG Intergenic
No off target data available for this crispr